Question 16 Prepreg material has the O the matrix by itself. The fibres are added later. O fibres and matrix in multiple layers O fibres separate from the matrix O matrix already spread on the fibres

Q: blema vork Uanswered rutrógeno genera un pulso que contiene 11.6 mJ de energia a 336.1 nm de largo…

A: Wavelength(L) = 336.1 nm    = 336.1 ×10-9 m Energy of photon = hC/L    = 6.626…

Q: Protein characterization Parameter molecular weight amino acid sequence native structure bioactivity…

A:

Q: If the enzyme maltase has a Vo of 0.25 mM per minute when [S] = 0.10 mM, and a Vo of 0.40 mM per…

A: The Vmax for the reaction in accordance with the Michaelis-Menten equation calculated as shown below…

Q: Given below is a sequence of DNA. Complete its complementary strand. 5’ AGCCCTGACGTGCCAGT 3’

A: Base complementary rules:  Adenine pairs with Thymine Guanine pairs with Cytosine Cytosine pairs…

Q: TATEMENTS: A - a clayey soil when flooded with a solution containing a negative dye, retains the dye…

A: Answer - The correct option is( D )- only statement B is true  Solution - According to the question…

Q: PBP3 DMF

A:

Q: 3. The following mineral analysis was reported for a water sample taken from a local NJ well.…

A:

Q: viii) You have the following stock solutions available: 2.5M Tris, 0.5M Glycine and 10% SDS, how…

A: To prepare 1 liter solution of 25mM tris, 190mM glycine and 0.1% SDS can be prepared by following.

Q: Ref ranges Results 3,7 mg/dl 35mg/dl 12.5 ml/min Tests Creatinine Females <1.2 BUN 5-20 Creatinine…

A: A 60-year-old woman with a history of rheumatoid arthritis, smoking of 60 packs/year, chronic…

Q: Calculate the melting temperature (TM) for the GFP primer- CATGGTCCTGCTGGAGTTCGTG (please give…

A: In DNA sequencing, A compliments T whereas G compliments C ( Chargaff Rule). The formula for…

Q: Which statement about luminescence is FALSE? Select one: O a. Luminescence is emission of light from…

A: False statement

Q: ted elution order of lysine, aspartic acid, and phenylalanine? ning

A: The order of elution depends on the side chains of the amino acids. The side chains will either lose…

Q: In the experiments of Barrick et al. (as shown), it was observed thatreplacement of histidine by a…

A: Hemoglobins have two alpha chains and two beta chains. When oxygen binds hemoglobin, there is a…

Q: Question 1 [CLO-2] If an Aspartate amino acid is in close proximity to Glutamate, the pKa will O a.…

A:

Q: What is the ln Ksp

A: ln ksp values given below

Q: what the key difference between SV-AUC and SE-AUC?

A: Analytical ultracentrifugation (AUC) is the technique that are used to study samples containing…

Q: T-LAB QUESTIONS Name: Lab stream: Date: 1. Why is the DNP compound coloured?

A: The question is based on the colour composition of DNP derivatives. we have to account for the…

Q: s Fe3+ is both enviromentally friendly is L UDdent in nature A in

A: The symbol Fe3+ represents iron in +3 oxidation state. It is also denoted as ferric ion. It is an…

Q: Question 5 A five-fold dilution was performed on a standard solution. The diluted solution will have…

A: Given that , A five fold dilution was performed on a standard solution.

Q: This is a Biochemistry lab question. For the lab we are spectrophotometrically determining the pka…

A: The Beer-Lambert Law states that the log of the ratio of the intensities is equal to the product of…

Q: In paper chromatogaphy lab, which dyes are least attracted to the stationary phase

A: Adjusting the polarity of the mobile phase caused different components to travel through the column.…

Q: What is chromophore and pigment? Provide website link of reference

A: Bioinorganic chemistry is branch of chemistry in which we study the chemical reaction in biology.

Q: Answer Q21, 22, 23

A: 21. Third statement is not correct. [Zn(NH3)4]+2  is sp3 hybridized. Vanadium has 5 valence…

Q: öllowing objects is superposable with its mirror image? Google bil YouTube Gmal M Option 2 O more…

A: Answer

Q: Using the three levels of protein structure, primary, secondary and tertiary answer the following:…

A: Explained as follows

Q: mCPBA CuC PhyPaCHCH, SnBu (HO. PAPPl NaOMe

A: The name of the following reaction are as: The reaction undergoes oxidation in presence of m-CPBA.…

Q: QUESTION 5 Which type of fibers result in a more isotropic composite? O Only long aligned fibers O…

A: Fibre have different strength and properties. Fiber orientation is important parameter that…

Q: Explain #21 pls

A: A question based on properties of liquids that is to be accomplished.

Q: nich of the following co oduct? O 136-137 °C O 50 °C D 120 °C O 98-104 °C 116-117 °C

A: According to the question, a student synthesize an impure product of a compound with a melting point…

Q: Paxlovid is treatment for COVID-19 that was recently approved for use because it can drastically…

A: Since you have posted a question with multiple sub-parts, we will solve first three subparts for…

Q: The glucose concontrations in a patent with midy clevated glucose loves were delomned by a…

A:

Q: Given the following peptideSEPIMAPVEYPK(a) Estimate the net charge at pH 7 and at pH 12. Assume the…

A:

Q: justify the ingridients of benadryl cream

A: The Benadryl cream is actually an itch stopping cream. It is used to relieve itching and pain…

Q: proteins 1 The sequence of amino acids an example of a protein structure. Select an answer and…

A: The sequence of amino acid an example of a primary  protein structure..

Q: 22-24 Choose the letter of the correct answer.

A: Multiple choice question.,

Q: The force constant katr of a backbone Ca – -C bond in a peptide is 250.0 kcal/mol/Angstrom² and the…

A: Given: Force constant (kstr) of bond = 250 Kcal/mol/Angstrom2  Equilibrium bond distance (r0) = 1.49…

Q: 70. This figure below is called adunt O myglobin O hemoglobin O globulin

A: Hemoglobin is a globular protein found in the RBCs, which are responsible for the transport of…

Q: 5. The purpose of SDS in SDS-PAGE is (a) to selectively bind the target protein. (b) to maintain…

A: SDS (sodium dodecyl sulphate) is an anionic detergent. SDS facilitates protein bifurcation. It…

Q: tant peaks on the printed determined the Structural the printed

A:

Q: The discovery of Walden showed retention of configuration was directly related to optical activity.…

A: Answer: Walden inversion basically explains the structural changes during the Sn2 reaction.

Q: 3 1 2 1 12 11 10 8 7 6 2 200 180 160 140 120 100 80 60 40 20 HSP-49-696 ppm Cos-05-332 ppm Compound…

A:

Q: Protein Z has an absorptivity (e) of 0.56 mL·mg1.cm 1 at 280 nm. You measure the absorbance at 280…

A:

Q: This technique uses the principle of isoelectric point to separate a mixture of proteins into its…

A: 1. Electrophoresis : Neutral amino acid contains one -COOH and one -NH2 groups. Hence, they exist as…

Q: D Question 9 By what physical property of the protein does SDS-PAGE technique separate different…

A: The first thing to know about how SDS-PAGE works is that it separates proteins according to their…

Q: Write a Chen ups reaction of EDTA binding with a heavy metal such as iron

A: EDTA is most wildely accepting chelating agent. EDTA has 2 nitrogen, 4 oxygen atom,that can form…

Q: Question 7 Select the correct option(s) regarding denaturation of proteins. O Proteins can be…

A: Denaturation  of protein.

Q: In SDS page, the elute from the column first. proteins will move through the gel fastest and first,…

A: SDS page and size exclusion chromatography are methods to separate proteins . In SDS page, charged…

Q: [NO]fîinal %3D

A:

UV Visible Spectroscopy

Spectroscopy refers to the absorption or emission of light or other radiations by matter. When a substance or chemical absorbs light or radiation, they reach an excited state followed by de-excitation or emission of the light or radiation forming distinct spectra. UV-visible spectroscopy or  ultraviolet-visible refers to the absorption and emission in the ultraviolet and visible regions of the electromagnetic spectrum.