Q: What type of mutation occurred to produce the abnormal sequence (nonsense or missense)? Explain your…
A: A mutation is a change in a DNA sequence.
Q: The following is the base sequence of DNA that codes for first eight amino acids of the β chain of…
A: As per the bartleby guidelines experts are allowed to answer only 3 sub-parts for a question. The…
Q: 1) Define the silent mutation in DNA? 2) What is the codon usage bias? 3) Provide one example of a…
A: DNA is the genetic material in most organisms. It is the information hub of the cell that contains…
Q: Silent mutations that occur in DNA are quite common in living cells and usually involve no effects…
A: A gene mutation is a permanent alteration that makes up a gene in the DNA sequence so that the…
Q: Identify the type of mutation that occurred to produce the abnormal hemoglobin. Explain why you…
A: Nonsense mutation: This is a condition in which a protein loses its function, resulting in sickness…
Q: What are frameshift mutations with an example
A: Gene mutations are rare and random changes in DNA sequence which result in alteration of polypeptide…
Q: The following is a list of mutational changes. For each of the specific mutations described,…
A: A mutation is defined as a change in the DNA sequence due to either mistake during DNA replication,…
Q: Define the silent mutation in DNA? (2.5 marks) 2) What is the codon usage bias? (2.5 marks) 3)…
A: Answer 1) Silent mutations are DNA mutations that do not result in a change to the amino acid…
Q: The following is a list of mutational changes. For eachof the specific mutations described, indicate…
A: Hello there! As you have posted multiple questions, we are answering only the first three questions…
Q: Below is a sequence of DNA.…
A: The process of identifying the coding region and the position of a gene in a genome is known as gene…
Q: An inappropriate base change that has no discernible effect is called a _____________ mutation.
A: The mutation is the process, which helps to change the bases in the DNA segment and exert different…
Q: Silent mutations that occur in DNA are quite common in living cells and usually involve no effects…
A: A mutation is a change that occurs in our DNA sequence, which might occur due to mistakes when the…
Q: The following are DNA fragments containing a small gene. The top strand is the coding strand.…
A: The genetic information of all living organisms (except some viruses) is stored in the cell in the…
Q: Given the following mismatch (highlighted in red), which base will be replaced after mismatch repair…
A: Normal metabolic activities and environmental exposure can cause DNA damage. DNA damage in human…
Q: In addition to the standard base-paired helical structures, DNA can form X-shaped hairpin structures…
A: Cruciform DNA is a form of non-B DNA that requires at least a 6 nucleotide sequence of inverted…
Q: The following RNA polymer is added to an E. coli extract, where it can be translated in all three…
A: A reading frame is the sequence of nucleotides in a nucleic acid (DNA or RNA) molecule read into a…
Q: Silent mutations that occur in DNA are quite common in living cells and usually involve no effects…
A: A gene mutation is a permanent alteration that makes up a gene in the DNA sequence, so that the…
Q: What type of mutation (missense, silent, and non-sense) was introduced in your sequence when G was…
A:
Q: In an ongoing research of the Philippine Genome Centre, using a repeating copolymers, ACA....…
A: A copolymer is a polymer made up of two or more species of monomer. Periodic copolymers are made up…
Q: Silent mutations that occur in DNA are quite common in living cells and usually involve no effects…
A: Silent mutations are mutations in DNA that do not have an observable effect on the organism's…
Q: Cause Would result in the following error Unbalanced nucleotide concentrations a) Sequence errors in…
A: The polymerase chain reaction is the method that is used for making copies of DNA, it is developed…
Q: If the code were a sextuplet (containing of six nucleotides), would the reading frame be restored by…
A: A frameshift mutation is induced by adding or deleting several nucleotides in a DNA sequence that is…
Q: You sequence the TBX1 gene from patients to diagnose if they have DiGeorge syndrome, and you find…
A: A chromosomal disorder where a small segment of 22 chromosomes is deleted. It is also an…
Q: These are written as either accurate or contain errors. Rewrite each one with an error as an…
A: The mutations in the genome are the source of the genetic variations in a population. The changes in…
Q: Silent mutations that occur in DNA are quite common in living cells and usually involve no effects…
A: A gene mutation is a permanent alteration that makes up a gene in the DNA sequence, so that the…
Q: 1) Define the silent mutation in DNA? 2) What is the codon usage bias?
A: Hi! As you have posted multiple questions and have not mentioned which one is to be answered, we are…
Q: For the following sequence, what is the Tm? 5'-AGCTACGATCAGGTCA-3'
A: Polymerase chain reaction (PCR) is a technique to amplify the sequence of DNA. A large quantity of…
Q: Which of the following represents a base analog acting as a mutagen? O ethidium bromide O guanine O…
A: In hereditary qualities, a mutagen is a physical or compound specialist that changes the hereditary…
Q: Although techniques are available for determining the sequences of amino acids in proteins, it is…
A: It is easier to sequence proteins indirectly by determining the base sequence of the gene for…
Q: Identify the dinucleotide CA repeat region and the score in the following sequence:…
A: Nucleotide is defined as the basic block of DNA and RNA that also known as building block of it.
Q: In studies of frameshift mutations, Crick, Barnett, Brenner, andWatts–Tobin found that either three…
A: The mRNA (messenger ribonucleic acid) contains an ORF (open reading frame) which is a continuous…
Q: What is the significance of the fact that many synonymous codons differ only in the third nucleotide…
A: Codons are the three consecutive nucleotides on mRNA which specify amino acids or stop signal for…
Q: If a base was added or deleted and the reading frame shifted, this would be an example of a…
A: Mutation is the change in the sequence of DNA. This may occur due to errors in DNA copying, Ionising…
Q: A standard codon table such as the one that we looked at in class gives the following information:
A: Three types of RNA interact to synthesize proteins. They are mRNA, tRNA, and rRNA.mRNA is the…
Q: The following is the base sequence of DNA that codes for amino acids 506-510 of the protein that…
A: Since we only answer up to 3 sub-parts, we’ll answer the first 3. Please resubmit the question and…
Q: Which amino acid sequence will be generated? 5'-GAAUGUCUUCGUUAUUGAUGUAGAA-3'
A: During translation mRNA is translated into amino acid sequence, by the help of various enzymes, tRNA…
Q: You are a researcher studying a gene you think is responsible for super human strength. You call the…
A: The two primers that is the forward primer and the reverse primer gets attached to different ends of…
Q: Which DNA strand is identical to the mRNA transcript? Which DNA strand codes the RNA transcript?
A: DNA contains the instructions for protein synthesis. Proteins in turn determine structure and…
Q: Silent mutations that occur in DNA are quite common in living cells and usually involve no effects…
A: A gene mutation is a permanent alteration that makes up a gene in the DNA sequence, so that the…
Q: The genetic code consists of a series of three-base wordsthat each code for a given amino acid.(a)…
A: The central dogma of molecular biology is the process of the formation of functional products by…
Q: Are the following base sequences sticky or not sticky? Each piece is written 5′ to 3′.(a) TTAGC and…
A: A base is nitrogen containing heterocyclic compound which, is found in DNA and RNA. There are…
Q: Describe the effects of nonsynonymous, synonymous, andnonsense mutations on a protein and the…
A: Non-Synonymous mutation: - Mutations which alter the amino acid sequence of a protein. Synonymous…
Q: Which of the following mutations involve the loss of one or more nucleotides from a gene sequence?…
A: Mutation is the change or alterations in the nucleotide sequence of genome of an organism. Mutation…
Q: what does the Hexa protein domain depict? (in relation with tay sachs disease)
A: Beta-hexoaminidase A is an enzyme that is present in the lysozyme. It breaks down a fatty substance…
Q: The following are DNA fragments containing a small gene. The top strand is the coding strand.…
A: DNA fragments – DNA is a Deoxyribonucleic acid. It is made up of two polynucleotide chains which are…
Q: Silent mutations that occur in DNA are quite common in living cells and usually involve no effects…
A: A silent mutation is a change in the sequence of nucleotide bases that constitutes DNA, without a…
Q: The following are DNA fragments containing a small gene. The top strand is the coding strand.…
A: The process by which DNA is copied to RNA is called transcription, and that by which RNA is used to…
Q: Line A below shows the peptide synthesized after transcription and translation of a piece of DNA.…
A: Any detectable, inheritable qualitative or quantitative changes in the genetic material of an…
Silent mutations that occur in DNA are quite common in living cells and usually involve no effects on
answers for the following questions?
What is the codon usage bias?
Step by step
Solved in 2 steps
- Silent mutations that occur in DNA are quite common in living cells and usually involve no effects onphenotype. In not more than 2 pages (using 1.5 line space of Arial or Times New Roman fonts) provideanswers for the following questions?1) Define the silent mutation in DNA? (2.5 marks)2) What is the codon usage bias? (2.5 marks)3) Provide one example of a clinical implication of a “silent mutation” that proven to have an effect onthe phenotype and provide a brief description of its molecular characteristics? (10.0 marks)Below is a sequence of DNA. 5'-ttaccgataattctctctcccctcttccatgattctgattaaagaaggcgagaacgaaactatttgttaatacc-3' How many "reading frames" can be identified for this sequence? How many "open reading frames" can be identified for this sequence? What is the frame of the longest ORF?Silent mutations that occur in DNA are quite common in living cells and usually involve no effects on phenotype. In not more than 2 pages (using 1.5 line space of Arial or Times New Roman fonts) provide answers for the following questions? 1) Define the silent mutation in DNA? 2) What is the codon usage bias? 3) Provide one example of a clinical implication of a “silent mutation” that proven to have an effect on the phenotype andprovide a brief description of its molecular characteristics? (Explain in details)
- For the following sequence please design an 18 base pair forward primer. ATGGCTGATAAGATAGAGAGGCATACTTTCAAGGTCTTCAATCAAGATTTCGAAAAAGAGCTGGAGTTTGGATTAGATAGAAAATATTTTTAGSilent mutations that occur in DNA are quite common in living cells and usually involve no effects on phenotype. In not more than 2 pages provide answers for the following questions?( please answer all the parts 1, 2 and 3) : 1) Define the silent mutation in DNA? 2) What is the codon usage bias? 3) Provide one example of a clinical implication of a “silent mutation” that proven to have an effect on the phenotype and provide a brief description of its molecular characteristics?For the following sequence please design an 18 base pair REVERSE primer. ATGGCTGATAAGATAGAGAGGCATACTTTCAAGGTCTTCAATCAAGATTTCGAAAAAGAGCTGGAGTTTGGATTAGATAGAAAATATTTTTAG
- Silent mutations that occur in DNA are quite common in living cells and usually involve no effects onphenotype. In not more than 2 pages (using 1.5 line space of Arial or Times New Roman fonts) provideanswers for the following questions? Provide one example of a clinical implication of a “silent mutation” that proven to have an effect onthe phenotype and provide a brief description of its molecular characteristics?What three different types of mutations involve changes in a single base, and what effect can each of them have on a coding sequence? Which type is the most common? Which type has the most severe effect on the function of the encoded protein?what does the Hexa protein domain depict? (in relation with tay sachs disease)
- Are the following base sequences sticky or not sticky? Each piece is written 5′ to 3′.(a) TTAGC and GCTAA(b) CGTACG and CCTTCGWhat is the result of Frameshift mutations from the insertion or deletion of nucleotides within the coding sequence?Human wildtype and mutant alleles are identical in sequence except for a single base-pair substitution that changes one nucleotide towards the end of intron 2. The wildtype and mutant sequences of the affected portion of the mRNA are listed in the following table. Explain how a single base substitution could alter the reading frame, which could result in a physiological disorder?
