Refer to the attached figure and label the 3 secondary conformations of DNA (i-iii) and discuss their difference in terms of: Overall propotions Helical rotation sense Bp per turn of the helix
Q: Which of the following statements concerning a DNA double-helix structures is incorrect? * the…
A: Deoxyribonucleic acid is a molecule that is composed of two polynucleotide chains that coil around…
Q: On diagram A: label the 3’ and 5’ end. is this strand more likely DNA or RNA. Why? On diagram…
A: The DNA and RNA both are nucleic acids that are composed of nucleotides. The nucleotides are…
Q: Select all of the statements that correctly describe DNA structure: Base pairing will always be…
A: DNA or deoxyribonucleic acid is the molecule that contains the genetic code of organisms. This…
Q: RNA forms a double helical structure
A: RNA is a polymer of ribonucleotides held together by 3',5'-phosphodiester bridges. There are certain…
Q: DIRECTION: Express the following DNA nucleotide bases into amino acids. A. 1. 3' ATA TTT CCG TAC CGC…
A: Answer: Introduction: Amino acid required for energetic procedures like the building of proteins and…
Q: Sequencing of the following fragment of single-stranded DNA needs to be undertaken using the Sanger…
A: Sanger sequencing, also referred to as the “chain termination method”, may be a method for…
Q: Label each statement about the polynucleotide ATGGCG as true or false. The polynucleotide contains…
A: 1. False (phosphodiester bonds are formed between two adjacent nucleotides in a nucleotide…
Q: Complete the following table and answer the next two questions. DNA____________ strand T…
A: The process of synthesis of RNA with the help of complementary strand of DNA is called…
Q: A double stranded DNA has Phosphate groups are on the outer surface of the double helix while the…
A: Enzymes are biocatalyst that increases the speed of reaction by lowering the activation…
Q: Label each statement about the polynucleotide ATGGCG as true or false. a. The polynucleotide has six…
A: A polynucleotide is a biopolymer that is composed of 13 or more nucleotide monomers covalently…
Q: Complete the table below to show the differences between a DNA molecule and an RNA molecule.…
A: Given: Differences between DNA molecule and RNA molecule.
Q: Consider an intact length of DNA consisting of 140 total nucleotides (70 nucleotides/strand), with…
A: Biomolecules are the compounds that are necessary for different biological processes occurring in a…
Q: The sequence below shows one strand of DNA. Parts of the sequence are in capital letters to help you…
A: Since you have posted a question with multiple sub-parts, we will solve first three sub-parts for…
Q: Draw the following strands of DNA 5’ C-A-T 3’ as well as the complementary base pairing strand…
A: Two strands of DNA twist around one another to form a double helix DNA and both are in anti-parallel…
Q: Consider the following wild-type double-stranded DNA sequence: 5' TATGAA AGT3 non-transcribed strand…
A: A gene mutation that results from the substitution of one base pair of another. TATGAAAGT non…
Q: Shown below is a DNA coding strand: 5' T-A-C-T-T-C-C-C-G-A-T-C-A-T-T 3' Using the genetic code…
A: The genes in DNA encode protein molecules, which serve as the cell's "workhorses," performing all…
Q: Which of the following nucleotides found in DNA is dGTP? Note, hydrogens bound to carbon atoms are…
A: A nucleotide consists of a sugar molecule (be it RNA ribose or DNA deoxyribose) bound to a phosphate…
Q: Which one of these indicated groups or bonds: hydroxyl; phosphate; triphosphate; nitrogen base;…
A: DNA carries genetic information. DNA is a double-stranded molecule. The strands of DNA double-helix…
Q: Using the Figure below identify: What is the significance of hydrogen bonds in double helix of DN…
A: Deoxyribonucleic acid, or DNA, is a molecule that holds the information that allows an organism to…
Q: The sequence below shows one strand of DNA. Parts of the sequence are in capital letters to help you…
A: Answer a. The sequence of the strand of DNA it would be paired within a double-stranded helix is…
Q: A strand of DNA runs the following direction with the following base sequence: 3'-AUG CCC CAG TTA -…
A: Nucleic acids are involved in various processes in the cell, their main role is the expression of…
Q: true or false: a nucleotide’s 5 end provides the energy to synthesize a new strand of DNA.
A: Replication is one of the essential properties of genetic material because the progeny cells should…
Q: An analysis of the bases in DNA present in body cells gave the following results: W units/g X…
A: DNA is a double stranded molecule which is a polymer of nucleotides. The components of nucleotides…
Q: Shown are several single stranded DNA sequences written in the 5' to 3' direction. Which of the…
A: A hair pin structure will be formed due to internal base pairing in a DNA molecule.
Q: Protein synthesis is a complicated process involving DNA being transcribed to RNA, which is then…
A: Protein synthesis is a complicated process involving DNA being transcribed to RNA, which is then…
Q: A molecule has the following percentages of bases: A= 42%, C = 14%, G= 21% and T=23%. Which of the…
A: Correct option is single stranded DNA i.e. option 2 is correct .
Q: The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to…
A: Replication is the process of the formation of identical copies of DNA. It takes place in the…
Q: Which of the following statement about the DNA double helix is correct А. Sugar-phosphate backbone…
A: DNA is composed of nucleotides attached together via phosphodiester bonds. DNA is known as…
Q: One strand of a DNA helix has the sequence: 5'-ATTGCCGTC-3'. Write the sequence of its complementary…
A: A DNA helix is an antiparallel helix that is wound on each other. It consists of two complementary…
Q: Write the complementary sequence for the following DNA sequence, in order from 3' to 5':…
A: Deoxyribonucleic acid (DNA) is the hereditary unit of life, which carries the genetic information in…
Q: Given the following sequence for one strand of a double-strand oligonucleotide: 5’ACCGTAAGGCTTTAG3’…
A: Nucleus is main controller of the cell which carries genetic instructions . It contain Chromosome…
Q: Which of the following statements is true of double stranded DNA? The double stranded structure is…
A: DNA is stabilised by hydrogen bonds, base stacking interaction, hydrophobic force, ionic…
Q: ns: In each box, type the hrst letter of the base that correctly matches the given DNA sequences C…
A: Answer. A nucleotide is the monomeric unit of nucleic acids. Nucleic acids are therefore also called…
Q: If a given double stranded DNA undergoes enzymatic hydrolysis targeting only the "a" side in the…
A: The hydrolysis is targetting the 3' Carbon of the sugar in the phosphodiester bond. 1st strand…
Q: Match the description on COLUMN A with their associated terms on COLUMN B. No overlapping answers…
A: S.No. DNA RNA 1 Deoxyribonucleic Acid. Ribonucleic Acid. 2 Generally…
Q: Using the DNA figure below to identify structures of the following letters: A= B= C= D= E= F: Circle…
A:
Q: In a sample solution given to be analyzed; CATAGCTTTGTTAAA (DNA nucleotide chain). Show the 5 'and…
A: DNA or deoxyribonucleotide chain is a double helical structure, containing nucleotide monomers,…
Q: Indicate the correct base order for the complementary DNA strand by placing the correct label in…
A: A DNA strand is formed of nitrogenous bases also called nucleobases. There are 4 nucleobases viz.…
Q: A DNA sample contains 21% adenine. What is the complete percentage base composition?
A: Given Values: dsDNA has A = 21%
Q: . Label each statement about the polynucleotide ATGGCG as true or false. a) The polynucleotide…
A: Polynucleotides are found naturally in all living organisms and play a variety of roles in them. A…
Q: Which of the following does NOT describe DNA as it occurs in Eukaryotic cells. CHOOSE ALL THAT…
A: Eukaryotic DNA DNA is the Deoxyribonucleic acid that constitutes genetic information and information…
Q: Show the separation pattern of the following DNA molecules on 1 % agarose gel. Justify your results.…
A: Introduction: Agarose gel electrophoresis is a molecular biology technique to analyze and separate…
Q: You are supplied with the following information about a DNA molecule: The molecular weight of a…
A: Introduction DNA is an organic molecule that includes genetic information as well as instructions…
Q: Definition of Nucleic Acid Classification (tabulate: classification,function, structure, example)…
A: The nitrogen-containing nucleotides that make up DNA and RNA are divided into two types. Purine and…
Q: Consider the following DNA molecule: ACG GTACACTTAC GA A T GCCAT G T GA A TG CTT 1) Draw the 2…
A: DNA stands for deoxyribonucleic acid. It is a nucleic acid, a polymer of nucleotides. A nucleotide…
Q: Using the DNA figure below to identify structures of the following letters: A= B= C= D= E= F: Circle…
A: DNA molecule is a polymer of nucleotides and each nucleotide has three main components that are…
Q: true or false Primary amines and keto groups of the nitrogen bases are involved in base-pairing in…
A: The nucleic acids are biopolymers made of nucleotides. The nucleotides are joined together by…
Q: Write out the DNA sequence using the following instructions: This is a double stranded DNA hydrogen…
A: The nucleotides polymers are responsible for determining and regulating the genetic characteristic…
Q: Which of the following are TRUE for RNA compared to DNA? Please select ALL correct answer options.…
A: Deoxyribonucleic acid(DNA) Polymer of deoxyribonucleotides. Usually double stranded. Have double…
Refer to the attached figure and label the 3 secondary conformations of DNA (i-iii) and discuss their difference in terms of:
Overall propotions
Helical rotation sense
Bp per turn of the helix
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- Using Figures 8.7 and 8.9 as a guide, draw a dinucleotide composed of C and A. Next to this, draw the complementary dinucleotide in an antiparallel fashion. Connect the dinucleotides with the appropriate hydrogen bonds. FIGURE 8.9 The two polynucleotide chains in DNA run in opposite directions. The left strand runs 5 to 3, and the right strand runs 3 to 5. The base sequences in each strand are complementary. An A in one strand pairs with a T in the other strand, and a C in one strand is paired with a G in the opposite strand. FIGURE 8.7 Nucleotides can be joined together to form chains caled polynucleotides. Polynucleotides are polar molecules with a 5 end (at the phosphate group) and a 3 end (at the sugar group). An RNA polynucleotide is shown at the left, and a DNA polynucleotide is shown at the right.Make the complementary strand for the following DNA template and label both strands as 5 to 3 or 3 to 5 (P = phosphate in the diagram). Draw an arrow showing the direction of synthesis of the new strand. How many hydrogen bonds are in this double strand of DNA? template: PAGGCTCGOH new strand:Given the following sequence for one strand of a double-strand oligonucleotide: 5’ACCGTAAGGCTTTAG3’ a. Write the sequence for the complementary DNA strand. b. Write the sequence of the RNA complementary to the strand shown
- For the following DNA sequence: 3’–CGATACGGCTATGCCGGCATT–5’ Write: a) the sequence of the complementary DNA strandA strand of DNA runs the following direction with the following base sequence: 3'-AUG CCC CAG TTA - 5' please note the direction of the strand and the sequence. Give the complimentary sequence of DNA, noting the direction of the sequence.List the DNA bases that will complementary base pair with the following sequence: A-G-C-T-A-C-G
- Translate the following opposite strand of DNA based on the nucleotide bases. ATTGACTGGGive the base sequence of the complementary DNA strand of the DNA chain with the following base sequence: 5’ ACGTAG 3’Write the sequence of the complementary strand of the following portion of a DNA molecule: 5 '–TAGGCTA–3 '.
- The sequence below shows one strand of DNA. Parts of the sequence are in capital letters to help you identify important features - capitalization does not affect the nucleotide indicated. 5' ...atacaATGcATGTCAaCTAcg[a]agatccgTAGaTAACATtCATatc...3' a) Underneath that strand, write the sequence of the strand of DNA it would be paired with in a double-stranded helix. Use the single letter code A-adenosine, G-guanosine, T-thymine, C-cytosine, and U-uracil, and remember to label the 5' and 3' ends b) Next, write the sequence of a possible mRNA transcript of the double-stranded DNA above. Remember that an mRNA must be translatable by a ribosome into a protein. Be sure to indicate 5' and 3' ends c) Using the genetic code at the end, translate your mRNA into the appropriate protein. Write the amino acid sequence of the protein using the single letter amino acid code (also at the end) below the mRNA sequence in (b) and label the amino and carboxy terminals d) Suppose the bracketed bold [a] were…Give the sequence of the complementary DNA strand for the DNA chain with the following base sequence5'-CTTGGATATC-3'Draw out the following DNA sequence on a whitesheet of paper along with itscomplementary strand. Just as we have practiced on the assignment. Label the ends (5' and 3) and make sure to associate those ends with the correct functional group. Include the proper number of hydrogen bonds between base pairs.3' CCAGGTACT 5'