Refute or support the statement: “Photosynthesis and oxidative phosphorylation are essentially the reverse of each other.”
Q: 3. β-oxidation of higher fatty acids: 3.1. tissue and intracellular localization of the process…
A: Fatty acids are very important class of macromolecules in our body. The degradation of fatty acid is…
Q: Two theories of membrane structure are discussed below. Unit Membrane Model Phospholipid molecules…
A: Membrane of the cell is also known as the plasma membrane or the cell membrane. The membrane is an…
Q: 4. What is the net charge (approximately) on the polypeptide shown below at pH 12.5? Lys - Arg - Val…
A: Amino acids are the building blocks of proteins. The structure of amino acid consists of a central…
Q: What is the abbreviated name of the human gene that contains the CAGATTGTGAAGAGGTCTCTTGA? following…
A: Nowadays there are various tools that are used in bioinformatics to find out the gene from the gene…
Q: Which energy system did you use for a vertical one-clap pushup or pushup? (Choose one) A) ATP-PC…
A: Answer ATP-PC system Explanation The ATP-PC system, also known as the phosphagen system, is the…
Q: B. Below is a short segment of a DNA molecule. Translate the DNA codon into mRNA. Use your data…
A: Transcription is the process of conversion of DNA to RNA, in this process the template strand is…
Q: 6. A portion of a gene is shown below. 5'-ATGATTCGCCTCGGGGCTCCCCAGTCGCTGGTGCTGCTGACGCTGCTCGTCG-3'…
A: mRNA, or messenger RNA, is a type of RNA molecule that plays a central role in the process of…
Q: Explain in quantitative terms the circumstances under which the following reaction can proceed in…
A: For a reaction to proceed (i.e. take place spontaneously) the change in Gibbs free energy (∆G) value…
Q: Lipids affect your health? why or why not
A: Lipids include fats, oils, waxes, and certain types of steroids. They are an essential component of…
Q: 1. What are buffers? 2. Using the pH scale, describe how you can indicate if the blood solution is…
A: Buffers are chemical systems which allows a solution to have a stable pH. Most buffers can help…
Q: A patient was admitted to the hospital with suspicion of malaria. After the examination was complete…
A: Glucose-6-phosphate dehydrogenase (G6PD) is an enzyme involved in pentose phosphate pathway. Malaria…
Q: 3) Which statement explains a way in which a researcher could cause a cytoplasmic protein to…
A: process of transporting cytoplasmic proteins into the nucleus 1. cytoplasmic protein contains an NLS…
Q: What do vaccines introduce into the body? short chain fatty acids antibodies lymphocytes phagocytes…
A: vaccines are biological preparations that help to stimulate an individual's immune system to produce…
Q: Use dAMP and dTMP to draw the two monomers together
A: Nucleotides are structural components of nucleic acids (DNA or RNA). Nucleotides are composed of a…
Q: 1. what is the reason why lactose is considered to have the least sweet taste from all other kinds…
A: Carbohydrates are one among the 4 classes of biomacromolecules. Based on the number of units…
Q: 12. Which of the following ligands cannot act as an ambidentate ligand? o nitrite, NO₂ o…
A: Ligand is a molecule which bind reversibly to the protein. A ligand may be any kind of molecule, it…
Q: explain the following prperties of G protein: structure of G- activation cycle and signaling pathway…
A: G proteins are the Guanine nucleotide binding proteins which functions in transducing signals…
Q: 1. 2. 3. Why does casein precipitates upon the addition of acetic acid? Why is milk used as an…
A: Casein is a phosphoprotein found in milk and so also called as milk protein. It has an isoelectric…
Q: Given the lipid structure below, part A was derived from __________ while part B was derived…
A: Glycerophospholipids have a structure similar to triacylglycerides, except that they are polar. They…
Q: 5 When your body metabolizes fat for energy, it gets 9 Cal./g, as opposed to only 4 Cal./g from…
A: Adipose tissue is a type of connective tissue which comprises fat cells, or adipocytes, which store…
Q: 1.a)Which one of the following is NOT broken down by the amylase enzyme? Amylopectin Starch Sucrose…
A: Enzymes are biological catalyst that speed up biochemical reactions. Enzymes are highly specific in…
Q: states the five functions of a globular protein and an example for each.
A: Proteins are large biomolecules composed of amino acids linked by peptide bonds. They play a vital…
Q: Cow's milk allergy (CMA) and lactose intolerance both result from dietary exposure to cow's milk and…
A: “Since you have posted multiple questions, we will provide the solution only to the first question…
Q: This assay is the most common method of detection in enzyme assays: A. рН B. spectrophotometric…
A: Enzymes are the biological catalysts that can convert substrate molecules to products. Enzyme assays…
Q: A carboxypeptidase is a metalloenyme (its active site contains one or more metal ions essential for…
A: An active site of an enzyme is a three dimensional structure that occurs within the enzyme. An…
Q: Consider a peptide with the sequence Ala-Glu-Arg-Leu. Assume the ionizable groups have the pKa…
A: Amino acid sequences are written with N-terminal amino acid on the left and C-terminal amino acid on…
Q: Identify what GalNAc, GlcNAc, Frutose and Sialic Acid are, draw them and describe their…
A: Carbohydrates chemically are polyhydroxy aldehydes or ketones. They serve diverse function roles…
Q: Can someone please show your work for tracking the radiolabel: draw structures indicating position…
A: The given structure is a polysaccharide - starch (amylose) with alpha 1,4 glycosidic bond. It…
Q: The catalytic mechanism of an enzyme found in the mitochondrial matrix (pH = 7.8) depends on an…
A: Dissociation of a weak acid is mathematically described by the Henderson-Hasselbalch equation: pH =…
Q: Some scientists debate whether it is correct to consider pyruvate as “the end of glycolysis”.…
A: Introduction All living organisms require energy. They get energy from cellular respiration.…
Q: Which one of the following statements concerning the nature of fats is correct? Saturated fats are…
A: Simple fat or fat or triglycerides are fatty acid esters of glycerol. They serve as fuel reserves…
Q: FoF1 ATPase is the enzyme that catalyzes ATP synthesis. The enzyme itself is deactivated. ATP. What…
A: Enzymes are biological catalyst that speed up biochemical reactions. Activity of enzymes refers to…
Q: 10. Assume you have the following stock solutions: 10% sodium dodecyl sulphate (SDS) V'S M NaOH…
A: Dilutions of any solutions can be calculated using the formula: C1V1 = C2V2 Where, C1= concentration…
Q: Buffers in pharmaceutical and biological systems
A: The pH of a solution refers to the concentration of H+ ions in a solution. If the H+ concentration…
Q: 23. Which is a general term indicating a carbohydrate polymer? A) Glycan B) Polycarb C) Multimer D)…
A: Chemically carbohydrates are polyhydroxy aldehydes or ketones. They have the general formula :…
Q: 1. Hexokinase and Glucokinase are two enzymes that catalyze the first reaction of glycolysis:…
A: Hexokinase and glucokinase are iso-enzymes which is involved in the first step and rate-limiting…
Q: Describe how each of the following relates to protein configuration: primary structure - secondary…
A: As per the central dogma of molecular biology, DNA contains the code that is necessary for the…
Q: Assess the role of redox electron transfer in the formation of an electrochemical proton gradient…
A: Aerobic catabolism of 1 molecule of glucose can produce 10 NADH (6 from acetyl CoA in the TCA cycle…
Q: d. Much of the experimental research on the propagation of nerve signals has focused on an…
A: Nernst potential (V) can be calculated using following equation V = RT/zF ln (Xout/Xin) where V is…
Q: Provide other techniques which can be used to characterize DNA extracts. Provide advantages and…
A: DNA extracts characterization is done by many methods. It is done to check purity, stability,…
Q: Some types of tumors express cell-surface receptors that are specific for unique peptide sequences.…
A: Of these 9 amino acids, 7 amino acids(H,W,S,Y,L,P,G) will be carrying a positive charge at pH 4. At…
Q: If the Vitamin C tablets are stored in a warm, humid bathroom cabinet, what might happen to the…
A: Vitamin C is also known as ascorbic acid. The important functions include maintaining healthy skin,…
Q: The measurement of alanine aminotransferase activity (reaction rate) usually includes an excess of…
A: If a particular reaction brings about a measurable change (like the generation or consumption of a…
Q: Give one example of a disease and briefly explain the molecular basis of the disease. apply the…
A: INTRODUCTION : Diseases and pathological conditions : A disease is a pathological condition in which…
Q: TRUE OR FALSE 1. Carboxybiotin is covalently linked to an enzyme via E- amino group of a lysine…
A: An enzyme is a substance that acts as a catalyst in the living systems. It increases the rate of…
Q: Question 3 The amino acid histidine is very important biologically and can also be used as a buffer.…
A: Amino acids are biomolecules that have an amino group, a carboxyl group and a side group linked to…
Q: 1. Draw the structure of a cholesterol ester where cholesterol is esterified with palmitic acid. is…
A: The four classes of biological macromolecules are nucleic acids, proteins, lipids and carbohydrates.…
Q: 2. In one paragraph, refute or support the statement: "Photosynthesis and oxidative phosphorylation…
A: There are a lot of metabolic processes that essential serve the opposite purposes of each other.…
Q: 3. Please draw the core structure of Lignan, and numbering the C-atoms.
A: In 1948, Haworth first introduced the term "Lignan", which are also subgroup of non-flavonoid…
Q: Draw two ringed a-D glucose monomers forming a disaccharide (maltose). Make sure to label the…
A: Glucose is a 6 carbon containing aldose sugar i.e. it is an aldohexose. The most stable ring form of…
Refute or support the statement: “Photosynthesis and oxidative phosphorylation are essentially the reverse of each other.”
Trending now
This is a popular solution!
Step by step
Solved in 2 steps with 1 images
- explain this question with as much detail please 1.Compare and contrast the reactions of the Citric Acid Cycle of Cellular Respiration with the reactions in the Calvin Cycle of Photosynthesis?Fill in the table below. In the first 2 columns, specify what you are comparing and contrasting in Oxidative Phosphorylation and Photosynthesis. In the second 2 columns describe in a 1-3 sentences, how they are the same and how they are different.The role of chlorophyll in photosynthesis is equivalent to that of the heme group in the mitochondrial electron transport chain. Say whether it is true or false, if it is wrong to justify it
- Defend this statement: “Oxidative phosphorylation and photophosphorylation by chlorophyll-based phototrophs differ primarily in the energy source driving the process.”True or False? In photosynthesis, both photosystems (I and II) depend on the energy of sunlight to excite a chlorophyll molecule until it releases an electron.ATP Is Generated During Photosynthesis and ___________ .
- Explain the difference between photosynthetic phosphorylation and oxidative phosphorylationTrue or false during the dark reaction of photosynthesis energy in the form of light is absorbed and converted to chemical energy in the form of a TPCan cyclic electron transport alone support photosynthesis? Explain your answer.
- Compare and contrast the calvin cycle and the krebs cycle.Compare and contrast the two phases of photosynthesis: the light reactions and the Calvin cycle. Include references to the reactants and products of both phases.TRUE or FALSE both photosystem I and photosystem II are involved in the cyclic electron transport chain I chose false and got it wrong, how is TRUE the correct answer and explain it to me so that i may understand where i went wrong