The measurement of alanine aminotransferase activity (reaction rate) usually includes an excess of pure lactate dehydrogenase and NADH in the reaction system. The rate of alanine disappearance is equal to the rate of NADH disappearance measured spectrophotometrically. How does this assay work?
Q: 1 what is the final electron acceptor in the electron transport chain 2 in oxidative…
A: Introduction DNA is a self replicating molecule. mRNA is produced from DNA by a process called…
Q: Which of the following is true of signal transduction mediated by protein tyrosine kinases…
A: Signal transduction is the process of transmission of chemical or physical signal intracellularly…
Q: Control of transcription in prokaryotes does not involve enhancers silencers Histone coding O…
A: Enhancers and silencers are DNA sequence acting as regulatory elements which acts as "turn on" or…
Q: Vitamin- derived coenzymes: A. NAD/ NADP B. FAD/ FMN C. THF D. All of the above  The following…
A: Coenzymes are the non protein organic molecules that help the enzyme to catalyse the biochemical…
Q: Total number of nadh molecules generated as a result of catabolism of one glucose molecule is a. 4…
A: Cellular respiration is a collection of three metabolic pathways that generate ATP by the oxidation…
Q: Time (s) 200 180 160 140 120 100 80 60 40 20 0 0 Change in absorbance vs Time 0.05 y = 660.47x…
A: Change in absorbance per minute at any wavelength can be determined by using the ratio of…
Q: Enzymatic Saccharification Saccharomyces cerevisiae/Turbo Yeast Preparation of Fermentation Saba…
A: Saba peels are the banana peels that are often regarded as waste. Turbo yeasts are a special strain…
Q: In order to stabilize a protonated Asp amino acid in an active site, an enzyme could: Choose the one…
A: Enzymes are usually protein which consist of reactant/substrate binding site called as active site.…
Q: Compared to an uncatalyzed reaction, an enzyme-catalyzed reaction ________. A) uses less substrate…
A: Enzyme kinetics is the study of the rates of chemical processes that are catalyzed by enzymes. The…
Q: Why was it necessary to use phosphoaminophosphonic acid-adenylate ester (ANP) in the ATP synthase…
A: As per the chemiosmotic Model, ATP synthase is the enzyme that phosphorylates ADP with Pi as…
Q: A type of diabetes mellitus is due to defects in insulin signaling. True False
A: Diabetes mellitus is a condition in which the insulin secretion from the pancreas is insufficient…
Q: How many mL of 10 x stock solution would you need to make 118 mL of 1x PBS? Report your answer to 1…
A: The equation of dilution: C1 x V1 = C2 x V2 Where, C1 is the concentration of the stock solution. C2…
Q: Which statement about glutamine amidotransferases is FALSE?
A: Glutamine amidotransferases is an enzyme which catalyzes the removal of ammonia group from glutamine…
Q: A. Given the following piece of messenger RNA (mRNA): CCUGCAGUAUGAAACGCCUGGUAGAAGGUGGGAAG…
A: The flow of genetic information from DNA to RNA, RNA to protein synthesis is called central dogma.…
Q: Differentiate reducing sugars from non-reducing sugars
A: Sugars are carbohydrates or saccharides. Sugars are ketone or aldehyde derivatives of straight-chain…
Q: B. Given that five molecules of glucose in eukaryotes underwent full oxidation and entered ETC, how…
A: ATP is the energy currency of the cell also known as 'molecular unit of currency', where it breaks…
Q: Which of the following is not true? A.) A single activating enzyme can interact with all the tRNAs…
A: The 'activating enzyme' mentioned in option 1 is aminoacyl tRNA synthetase. Aminoacyl tRNA…
Q: You have purified a recombinant form of the p53 protein from E. coli and determined the A280 to be…
A: Beers law states that the absorbance of a sample depends on the amount of sample present and path…
Q: Assess the role of redox electron transfer in the formation of an electrochemical proton gradient…
A: Biological oxidation-reduction reactions involve the transfer of electrons from one biomolecule,…
Q: OXIDATIVE PHOSPHORYLATION: 3A) Thoroughly explain the biological significance of NADH/H* and FADH2…
A: All life forms require energy. We obtain this energy from the food we eat. It is the highly reduced…
Q: describe five physiological effects which are mediated by G proteins
A: G proteins are guanosine binding proteins, which mediate GPCR signaling pathways. There are two…
Q: Which of the following statements is INCORRECT? OA) The inhibition of phosphofructokinase leads to…
A: In the process of glycolysis, the six-carbon sugar glucose is divided into two molecules of the…
Q: Which of the following is an allosteric activator of mammaliah carbamoyl phosph synthetase? OA)…
A: Introduction Carbamoyl phosphate synthetase is an enzyme that has 3 different forms. Carbamoyl…
Q: PK 12.5 HO. ОН PK,43 Compound X О
A: The compound X has two distinct stages, corrresponding to deprotonation of two different groups. At…
Q: Question 24 Which of the following is not a cell surface receptor? GPCR DNA-associated receptor RTK…
A: Biochemical cell signalling is the method by which cell communicates with each other cells and…
Q: Given the following mRNA transcript: 5’-UUUGGCAUGGGUAUCGUAGAGAUGGAAUUCAUAGUGGAGUAA-3’ Determine the…
A: Genes are functional segments of DNA that code for particular proteins. Each gene has its unique…
Q: Metabolism processes that generate fadh2 are select all that apply beta oxidation…
A: FAD is a derivative of the vitamin B2 or Riboflavin. It acts as coenzyme in most of the oxidation…
Q: In isolating and characterizing carbohydrates, choose between starch and cellulose from a plant…
A: Carbohydrates are composed of carbon, hydrogen and oxygen (CH2O) which performs several functions in…
Q: Dihydrofolate reductase is used twice for the reduction of folate to tetrahydrofolate. 2.…
A: Enzymes are high molecular weight proteins that catalyse biochemical reactions. Sometimes enzymes…
Q: How is osmosis different from simple diffusion? Oosmosis involves the movement of water, simple…
A: The two forms of passive transport that are essential for transporting molecules into and out of the…
Q: All of the following classes of enzymes catalyze the Fatty acid synthesis except a. synthetase b.…
A: Triglycerides are storage lipids. These are fatty acid esters of glycerol. Excess of Acetyl CoA…
Q: The following are effects. role of glycosylation, EXCEPT molecular recognition in immunologic…
A: Since you have posted multiple questions we will answer the first question for you. Please repost…
Q: Which of the following is NOT a true statement about the diagram below? Intermediate A Pathway…
A: Enzymes are the biocatalysts that mediate the biochemical reactions of metabolic pathways. They have…
Q: how do we name the bond between monomer B and monomer C
A: Chemically carbohydrates are polyhydroxy aldehydes or ketones. They have the general formula :…
Q: 1.0 ml of serum albumin (BSA) solution was precisely diluted to 100 ml with a buffer solution, and…
A: The proteins molecules are constituted of twenty naturally occurring amino acids. The aromatic amino…
Q: Match the following steps of oxidative phosphorylation in increasing order from beginning (1) to end…
A: Oxidative phosphorylation is the process by which oxidation of NADH and FADH2 by the complexes in…
Q: 1 Draw the following polypeptide: Met- Tyr-Val-Ser-Asn 2A Draw the hydrolysis of a dipeptide…
A: A peptide is a chain of amino acids, in which the amino acids are joined together through peptide…
Q: 7. All amino acids have a chiral a-carbon EXCEPT A) Proline B) Alanine C) Glycine D) Tryptophan 8.…
A: Since you have posted multiple MCQ questions, we will provide the solution only to the first three…
Q: The question is not being answered for either of them. What is the maximum ATP including converting…
A: Electron Transport Chain (ETC) located in the inner mitochondrial membrane, consist of four protein…
Q: Question 11 Matching: (one answer can be matched to more than one questions). An answer can be used…
A: Liposomes and micelles are composed of phospholipids. Lets first know the characteristics of…
Q: Cow's milk allergy (CMA) and lactose intolerance both result from dietary exposure to cow's milk and…
A: “Since you have posted multiple questions, we will provide the solution only to the first question…
Q: which of the following types of information is provided by a suffix? A) numbers b) positions…
A: Prefix, root word and suffix are used to define and complete medical terminologies. Prefix is…
Q: The peptidyl transferase reaction is an exemplification that the ribosome is a ribozyme. True False
A: Enzymes are bio-catalyst that participate in biochemical process and they are highly specific in…
Q: Assess the role of redox electron transfer in the formation of an electrochemical proton gradient…
A: All processes that would end up releasing energy will take place spontaneously. This energy released…
Q: 1) Tabulate the differences and/ or similarities of the different kinds of coenzymes and cofactors.…
A: "Since you have asked multiple questions, we will solve the first eight questions subparts for you.…
Q: In protein structure, which is not established via secondary interactions? o tertiary o secondary o…
A: Proteins are polymers of amino acids linked by peptide/amide bond with release of one water molecule…
Q: Choose the correct path taken by a pair of electrons as they travel down the electron-transport…
A: Electron transport chain consists of a group of protein complexes in the mitochondrial membrane…
Q: Two theories of membrane structure are discussed below. Unit Membrane Model Phospholipid molecules…
A: Membrane of the cell is also known as the plasma membrane or the cell membrane. The membrane is an…
Q: In prokaryotic RNA synthesis the rate of incorporation of nucleotides is constant throughout the…
A: In prokaryotes, RNA synthesis is carried out the enzyme RNA Polymerase. RNA Polymerase read the DNA…
Q: Sulfur compounds give onions their unique flavor and properties. Compound 1 is the starting material…
A: Allinase is an enzyme which catalyzes a biochemical reaction in which S-alkyl-L-cysteine S-oxide…
Answer this question
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- Assessing the Effect of Active-Site Phosphorylation on Enzyme Activity (Integrates with Chapter 15.) The serine residue of isocitrate dehydroenase that is phosphorylated by protein kinase lies within the active site of the enzyme. This situation contrasts with most other examples of coa1ent modification by protein phosphorylation. where the phosphorylation occurs at a sate remote from the active site. What direct effect do you think such active-site phosphorylation might have on the catalytic activity of isocitrate dehydrogcn.ise? (Sec Barford, D., 1991. Molecular mechanisms for the control of enzymic activity by protein phosphorytation. Biochimica et Biophysica Acta 1133:55—62.)ATP is a (+) allosteric effector, and CTP is a (-) allosteric effector of theenzyme ATCase. Both of these heterotropic effectors bind to the regulatorysubunits on ATCase. The substrates of ATCase, aspartate and carbamoylphosphate, bind the enzyme active site with positive cooperativity (i.e.,they exert a “+” homotropic effect on activity). As the concentrations ofthe substrates change from values where [S] ≪ KM to values where [S] issaturating ([S]≫ KM), how will the binding constants for each of the twoallosteric effectors change? In other words, does ATP bind ATCase withhigher affinity when [S] is low or high? Does CTP bind ATCase with higheraffinity when [S] is low or high?In the first cycle of fatty acid synthesis via the acyl carrier protein system, the acetyl group on fatty acid synthase condenses with the malonyl-ACP complex. Draw the structure of the products of this reaction. Respresent ACP by R1 do not include free synthase Be sure to include charges on atoms at Ph=7
- Regulation of Glutamine Synthetase by Covalent Modification Suppose at certain specific metabolite concentrations in vivo the cyclic cascade regulating E. coli glutamine synthetase has reached a dynamic equilibrium where the average state of GS adenylylation is poised atn=6. Predict what change in nwill occur if: [ ATP ] increases, PIIA/PIID increases, [ -KG ]/[ Gln ] increases, [ Pi ] decreases.Tracing the Fate of CO2 During Photosynthesis 14C-labeled carbon dioxide is administered to a green plant, and shortly thereafter the following compounds are isolated from the plant: 3-phosphoglycerate, glucose, erythrose-4-phosphate, sedoheptulose-1 .7-bisphosphate, and ribose-5-phosphate. In which carbon atoms will radioactivity be found?Energetic of Fructose-1 ,6-bis P Hydrolysis (Integrates with Chapter 3.) The standard free energy change (G) for hydrolysis of fructose-1. 6-bisphosphate (FBP) to fructose-S-phosphate (F-6-P) and P: is -16.7 KJ/mol: FBP + H2O fructose-6-P + Pi The standard free energy change (G) for ATP hydrolysis is -30.5 KJ/mol: ATP + H2O ADP + Pj What is the standard free energy change for the phosphofructokinase reaction: ATP + fructose-6-P ADP + FBP b. What is the equilibrium constant for this reaction? c. Assuming the intracellular concentrations of [ATP] and (ADP] are maintained constant at 4 mM and 1.6 mM, respectively, in a rat liver cell, what will be the ratio of [FBP]/[fructose-6-P] when the phosphofructokinase reaction reaches equilibrium?
- Why Do Anabolic and Catabolic Pathways Differ? Why is the pathway for the biosynthesis of a biomolecule at least partially different from the pathway for its catabolism? Why is the pathway for the biosynthesis of a biomolecule inherently more complex than the pathway for its degradation?Figure 27.3 illustrates the response of R (ATP-regenerating) and U (ATP-utilizing) enzymes to energy charge. a. Would hexokinase be an R enzyme or a U enzyme? Would glutamine: PRPP amidotransferase, the second enzyme in purine biosynthesis, be an R enzyme or a U enzyme? b. If energy charge = 0.5: Is the activity of hexokinase high or low? Is ribose-5-P pyrophosphokinase activity high or low? c. If energy charge = 0.95: Is the activity of hexokinase high or low? Is ribose-5-P pyrophosphokinase activity high or low?Distinguishing the Mechanisms of Class I and Class I Aldolases Fructose bisphosphate aldolase in animal muscle is a class 1 aldolase, which forms a Schiff base intermediate between substrate (for example. fructose-1, 6-bisphosphate or dihydroxyacetone phosphate) and a lysine at the active site (see Figure I8.12). The chemical evidence for this intermediate conies from studies with aldolase and the reducing agent sodium borohydride, NaBH4. Incubation of the enzyme with dihydroxyacetone phosphate and NaBH4 inactivates the enzyme. Interestingly, no inactivation is observed if NabH4 is added to the enzyme in the absence of substrate. Write a mechanism that explains these observations and provides evidence for the formation of a Schiff base intermediate in the aldolase reaction.
- Explaining the Stoichiometry of Fatty Acid Synthesis Carefully count and account for each of the atoms and charges in the equations for the synthesis of palmitoyl-CoA, the synthesis of malonyl-CoA, and the overall reaction for the synthesis of palmitoyl-CoA from acetyl-CoA.Understanding Enzyme Mechanisms Related to Pyruvate Carboxylase Based on the mechanism for pyruvate carboxylase (Figure 22.3), write reasonable mechanisms for the reactions that follow:Modeling the Regulation of AcetyI-CoA Carboxylase Based on the information presented in the text and in Figures 24.4 and 24.5, suggest a model for the regulation of acetyl-CoA carboxylase. Consider the possible roles of subunit interactions, phosphorylation, and conformation changes in your model.