Draw two ringed a-D glucose monomers forming a disaccharide (maltose). Make sure to label the glycosidic linkage formed. Note that a specific molecule has been lost after each of these monomers bind together. Which molecule is lost?
Q: * You can keep extra decimal places through most of this problem, but round your final estimate to…
A: Spectrophotometry is a technique to measure the light absorption by a substance. It is classified…
Q: b) How does oxygen availability determine the fate of the glycolysis pathway?
A: Glycolysis is a central metabolic pathway that is used by all cells for the oxidation of glucose for…
Q: Nadph is primarily produced in the ___ through the ___ process. it is consumed during ___ a.…
A: After glucose enters a cell, it is immediately converted to glucose 6-phosphate. Glucose 6 phosphate…
Q: Metabolism processes that generate fadh2 are select all that apply beta oxidation…
A: FAD is a derivative of the vitamin B2 or Riboflavin. It acts as coenzyme in most of the oxidation…
Q: Which method of chromatography would be the most appropriate for separating mixtures of the…
A: Chromatography is a technique used to separate molecules based on their Solubility in mobile and…
Q: Passage 1 (Questions 1-4) Human immunodeficiency virus 1 (HIV-1) protease inhibitors have been…
A: Since you have posted multiple questions, we will provide the solutiononly to the first question as…
Q: What are the other abundant source of lipids aside from egg yolk. Provide details on how you can be…
A: Lipids are a type of organic molecule that contains fatty acids as their monomers. They are there in…
Q: ATP is the primary source of cellular energy. What qualities of ATP make it a useful energy…
A: ATP acts as the “energy currency” of the cell. The energy that is released during fuel oxidation in…
Q: Given the following mRNA transcript: 5’-UUUGGCAUGGGUAUCGUAGAGAUGGAAUUCAUAGUGGAGUAA-3’ What is the…
A: The proteins are constituted of twenty naturally occurring amino acids. Each amino acid is encoded…
Q: Although as a whole, metabolic pathways are thermodynamically favorable, there’s at least one…
A: The Delta G of a reaction can be calculated as follows. Delta G = Delta G0 + RTln(Q) Where R =…
Q: what is the net reaction of the citric acid cycle for a single acetyl coenzyme A molecule? what are…
A: TCA cycle is also called as Krebs cycle a cyclic process that converts Pyruvate to CO2. It is a…
Q: Fatty acids released by hormone sensitive lipase in adipocytes are transported to muscle by: OA)…
A: The adipose tissue stores surplus nutrients in the form of neutral lipids in the body that in turn…
Q: *Determine the ATP yield from the metabolism of one molecule of glucose under the following…
A: Cellular respiration is a collection of three metabolic pathways that generate ATP by the oxidation…
Q: Given the following coding strand sequence of DNA, what is the template strand sequence?…
A: Nucleic acids are biomolecules that are essential for all life forms. They are polymers of…
Q: In order to stabilize a protonated Asp amino acid in an active site, an enzyme could: Choose the one…
A: Enzymes are usually protein which consist of reactant/substrate binding site called as active site.…
Q: Which is true about signaling receptors? They are transmembrane proteins that have binding…
A: Signalling receptors are the transmembrane proteins that span the plasma membrane of the cell. they…
Q: 1 Draw a general sketch ( backbone only ) of a protein alpha- helix and a beta shet.
A: Hi, thank you for the question. As per the honor code, we'll answer the first question since the…
Q: LDL is a metabolite of VLDL. Under normal physiological conditions, LDL that is internalized by a…
A: The low density lipoproteins that collect on the walls of blood vessels, raises the possibility of…
Q: he initial velocity data shown in the table were obtained for an enzyme. Each assay at the…
A: Michaelis-Menten described the relationship between reaction velocity and substrate concentration.…
Q: Describe the role of sodium and phosphomolybdate reagent in Folin Wu method.
A: NOTE : Since you have posted multiple questions, we will provide the solution only to the first…
Q: What is ATP? Explain in two sentences. 2. How is ATP produce in Glycolysis? Kreb Cycle? Electron…
A: Individual cells release energy through the process of cellular respiration, which involves the…
Q: The lens of the eye si the light refracting medium of the eye, and ti has no mitochondria. Glucose…
A: "Since you have posted a question with multiple sub parts, we will provide the…
Q: 9. Compartmentation in ß Oxidation Free palmitate is activated to its coenzyme A derivative…
A: Beta oxidation is the biochemical pathway by which fatty acids are broken down two carbon at a time…
Q: Describe the role of each of the membrane proteins shown in the picture below. Think about what is…
A: The NADH and FADH2 formed during the glycolysis and TCA cycle transfer electrons to the oxygen. The…
Q: The following compound is best identified as (blank). O *NH3-CH-C-NH-CH-COO- Ť" CH3 CH₂ OH O a…
A: Any living cell is made up of biomolecules. These biomolecules can be classified into the following…
Q: A major challenge to cells that are metabolizing amino acids is: A) changes in pH due to acidic and…
A: Amino acids are biomolecules that have an amino group a carboxyl group and a side group attached to…
Q: State the function and desired products of the hexose monophosphate shunt pathway.
A: Cells metabolize glucose molecules through the glycolytic pathway to release the energy required for…
Q: Plot a line weaver-burk graph for Km=6.30mM and Vmax=360uM/min when an experiment has 5 tubes with…
A: Enzymes kinetics is studied using the Michalis-Menten kinetic equation and the plot of S Vs Vo…
Q: Leu 93 Val 49. Are these two residues polar or hydrophobic (nonpolar)? What effect should their…
A: Amino acids are biomolecules that have an amino group, a carboxyl group and a side group attached to…
Q: onsider the following tripeptide: Gly—Ala—Val What is the charge of the primary structure of…
A: Amino acid sequences are written with N-terminal amino acid on the left and C-terminal amino acid on…
Q: Carnitine combines with fatty acids groups to form acyl carnitine through carnitines ____ group…
A: Beta oxidation of fatty acids takes place in mitochondrial matrix. For this, first the fatty acids…
Q: What is the abbreviated name of the human gene that contains the CAGATTGTGAAGAGGTCTCTTGA? following…
A: Nowadays there are various tools that are used in bioinformatics to find out the gene from the gene…
Q: Describe method by which uncoupling agents (like 2,4-dinitrophenol) inhibit oxidative…
A: The oxidation of carbohydrates such as glucose generates electrons that are carried to the electron…
Q: Which of the following tripeptides has a net charge of +1 at pH 8? O SIT OPEN OAKT DIG OWTG
A: Peptides are made up of amino acids. Every amino acid have an alpha-carbon that is bonded to 4…
Q: explain the following prperties of G protein: structure of G- activation cycle and signaling pathway…
A: G proteins are the Guanine nucleotide binding proteins which functions in transducing signals…
Q: Responses elicited by cAMP production EXCEPT glycogen breakdown increased secretion of…
A: G-protein is a GTP binding protein that is found closely associated with the receptor called…
Q: why the Shine–Dalgarno sequence is important to prokaryotes？State the bases of prokayotes’ mRNA
A: Shine–Dalgarno sequence is a short stretch of polypurine sequence ( 4 to 9 purine nucleotides) in…
Q: Identify different types of organic reaction mechanism (SN1, SN2, etc) and reaction types (addition,…
A: SN1 reactions are substitution nucleophilic reactions that occur in a single step. They involve the…
Q: Enzyme A catalyzes the reaction S → P and has a KM of 50 μM and a Vmax of 100 nM s–1. Enzyme B…
A: The MM (Michaelis Menten) equation gives us the initial rate of a single substrate enzyme catalyzed…
Q: 3. β-oxidation of higher fatty acids: 3.1. tissue and intracellular localization of the process…
A: Fatty acids are very important class of macromolecules in our body. The degradation of fatty acid is…
Q: how many ATPs result from from oxidative phosphorylation of one NADH; tell how many ATPs result from…
A: During the oxidation of NADH in the process of oxidative phosphorylation, NADH donates a pair of…
Q: Total number of nadh molecules generated as a result of catabolism of one glucose molecule is a. 4…
A: Cellular respiration is a collection of three metabolic pathways that generate ATP by the oxidation…
Q: DNA: AGA ACA TAA TAC CTC TTA ACA CTC TAA AGA CCA GCA CTC CGA TGA ACT GGA GAC…
A: As per the central dogma of molecular biology, genetic information is stored in the DNA. The genetic…
Q: ）picture1: what bond is this between cytosine and ribose？ 2）picture2 ： what bond is that bewteen…
A: Nucleotides are compounds made up of a nitrogen base, a sugar and a phosphate. The base can be…
Q: (a) Where might bends or 3 turns occur? (b) Where might intrachain disulfide cross-linkages be…
A: Proteins are made up of amino acids that are linked together by peptide bonds. The simple linear…
Q: In term of the sugar identity , what is the difference between DNA and RNA. 2 What nucleobases are…
A: Deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) are two of the most important molecules in…
Q: Ammonia enters the urea cycle as: OA) aspartate. OB) glutamate. OC) carbamoyl phosphate. D) NH4*.
A: The urea cycle is the main metabolic pathway involved in the removal of nitrogenous waste that is…
Q: c) Explain why the proton Mitchel's proton gradient mechanism is implausible. What is the most…
A: The chemiosmotic theory (some would argue that it is still a hypothesis and not a theory) is well…
Q: In isolating and characterizing carbohydrates, choose between starch and cellulose from a plant…
A: Carbohydrates are composed of carbon, hydrogen and oxygen (CH2O) which performs several functions in…
Q: Select lipid samples under triacylglycerol (one simple and one mixed), phospholipid, and…
A: Lipids are biomolecules that do not have a fixed chemical structure like carbohydrates or amino…
Step by step
Solved in 2 steps with 1 images
- In the following list, identify the carbohydrate, the fatty acid, the amino acid, and the polypeptide: a. NH2CHRCOOH b. C6H12O6 c. (methionine)20 d. CH3(CH2)16COOHMatch lipid structures in column A with its lipid type in column B esters of fatty acids with long chain alcohols one or more double C=C bonds only single C-C bonds glycerol backbone with esters of fatty acids glycerol backbone containing fatty acid esters with phosphate group sphingosine-containing lipid…Identification. Write in CAPITAL LETTERS. Wrong spelling, wrong. Carbohydrates may contain 1 sugar unit (________________________), 2 sugar unit (__________________________), or many sugar units (_____________________________). Proteins are polymers from monomers called ______________________ that are linked by a covalent bond called ________________________, hence, the term ________________________ is also applied to proteins. Proteins are classified according to function,examples of these classes are: _____________________, ________________________, ____________________________, ______________________________, ____________________________, ___________________________, _____________________________.
- Arrange the fatty acids from highest melting point to lowest melting point.arrange the following lipids in order of decreasing polarity: cholesterol, triglyceride, estradiol, fatty acid, phosphatidyl cholineTRUE OR FALSE Lipids are insoluble in water but soluble in ether TAG mean triacylglycerol Phospholipids function as membrane lipids TAG contains fatty acids and glycerol Fatty acids contains even number of carbon atoms Saturated fatty acids have low melting points Butyric acid usually comes from coconut oil Unsaturated fatty acids contain single bonds only in their structure Arachidonic acid contains 3 double bonds Theobroma oil is a liquid fat