Use the bottom strand in question 1 and use the bottom strand in question 4 DNA MUTATIONSUse the following information to answer the next three questions.Segment of DNASGCTAACCTGATCGCCGGTATT 33'CGATTGGACTAGCGGCCATAAS1. Transcribe and translate the above segment of DNA.2. A point mutation occurs in the above segment of DNA. Nucleotide #14 issubstituted by a nucleotide containing cytosine. Determine the sequence ofamino acids in the polypeptide chain. Show all your work. Is there any visibleeffect of the mutation, that is, is it a silent mutation?3. The DNA segment above is mutated at nucleotide #12. The new nucleotidecontains adenine. Transcribe and translate the new DNA segment. What effect,if any, does this have on the protein sequence? Explain.Use the following information to answer the next three questions.Segment of DNASTGCAAATTTGTC 3°3'ACGTTTAAACAG *4. Transcribe and translate the above segment of DNA.5. A point mutation occurs in the above segment of DNA. Nucleotide #2 isdeleted. Determine the sequence of amino acids in the polypeptide chain.Show all your work. Is there any visible effect of the mutation, that is, is it asilent mutation?6. A nucleotide containing thymine is inserted between nucleotides #7 and #8.Transcribe and translate the new DNA segment. What effect, if any, does thishave on the protein sequence? Explain.

Name: Use the bottom strand in question 1 and use the bottom strand in quest
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: Use the bottom strand in question 1 and use the bottom strand in question 4 DNA MUTATIONSUse the following information to answer the next three questions.Segment of DNASGCTAACCTGATCGCCGGTATT 33'CGATTGGACTAGCGGCCATAAS1. Transcribe and translate the ab

The change in nucleotide is called a mutation. it could be a point mutation when one nucleotide is…

Science

Biology

Segment of DNA SGCTAACCTGATCGCCGGTATT 3'CGATTGGACTAGCGGCCATAAS 3' 1. Transcribe and translate the above segment of DNA. 2. A point mutation occurs in the above segment of DNA. Nucleotide #14 is substituted by a nucleotide containing cytosine. Determine the sequence o amino acids in the polypeptide chain. Show all your work. Is there any vi: effect of the mutation, that is, is it a silent mutation? 3. The DNA segment above is mutated at nucleotide #12. The new nucleotide contains adenine. Transcríbe and translate the new DNA segment. What en if any, does this have on the protein sequence? Explain

Segment of DNA SGCTAACCTGATCGCCGGTATT 3'CGATTGGACTAGCGGCCATAAS 3' 1. Transcribe and translate the above segment of DNA. 2. A point mutation occurs in the above segment of DNA. Nucleotide #14 is substituted by a nucleotide containing cytosine. Determine the sequence o amino acids in the polypeptide chain. Show all your work. Is there any vi: effect of the mutation, that is, is it a silent mutation? 3. The DNA segment above is mutated at nucleotide #12. The new nucleotide contains adenine. Transcríbe and translate the new DNA segment. What en if any, does this have on the protein sequence? Explain

Biology Today and Tomorrow without Physiology (MindTap Course List)

5th Edition

ISBN:9781305117396

Author:Cecie Starr, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Christine Evers, Lisa Starr

Chapter6: Dna Structure And Function

Section: Chapter Questions

Problem 1DID

See similar textbooks

Similar questions

Name 2 differences in the structural features of DNA and RNA and indicate the relevance of each difference to the function/s of DNA and RNA. Number your answers.
In one paragraph, using your own words, describe the structure of DNA. Be sure to include the following terms: nucleotide, phosphate, adenine, cytosine, guanine, and thymine.
1. Below is an amino acid sequence for the following strand of DNA:A G C A A T C C G T C T T G GT C G T T A G G C A G A A C CThat strand has mutated. It is nowA G C A A C C C G T C T T G GT C G T T G G G C A G A A C CUse your knowledge of mutation and protein synthesis to answer the following questions.What mutation has occurred? A. point mutation B. movement of large section of chromosome C. duplication of entire chromosome D. genetic recombination 2. Will this mutation have a real effect? Why or why not?
ANSWER ALL THE QUESTIONS: SELECT ALL THAT APPLIES: 1. Which of the following comprise a DNA helix structure? A. Carbohydrate backbone B. Nitrogenous base C. Protein backbone D. Phosphate group 2. Which of the following elements is(are) utilized for the generation of ATP among bacterial cells? a. Nitrogen b. Sodium c. Phosphorus d. Potassium 3. Which of the following is(are) considered as growth factors essential for the growth of bacteria? a. Carbohydrates b. Purines c. Amino acids d. Protein
Answer the following whether it is TRUE or FALSE: 1. For each DNA segment 3'-ACCTGCCTACCCG-5' the sequence of the mRNA molecule synthesized is 5'-TGGACGGATGGGC-3' 2. In the template strand TACCGAGGTATGTAC, the coding strand is 5'-ATGGCTCCATACATG-3'. 3. In the template strand TACCGAGGTATGTAC, the coding strand is 5'-AUGGCUCCAUACAUG-3'. 4. The template strand is the strand of DNA used for RNA synthesis. 5. Transcription forms a messenger RNA molecule with a sequence that is identical to the DNA template from which it is prepared.
Can you please check my answer and make sure it is correct? Question: Why are hydrogen bonds so vital to the structure of DNA? Hydrogen bonds are important for DNA because they are the bonds between the bases and help DNA form into its double-stranded shape. These bases include adenine, thymine, guanine, and cytosine. Adenine forms two hydrogen bonds with thymine and guanine forms three hydrogen bonds with cytosine. The resulting double-strands are held together by hydrogen bonds which is an important characteristic for DNA. These weak bonds are stable, but can be separated when it is necessary. This process is necessary during DNA replication, when a duplicate copy of DNA is being made or during the denaturation step in PCR.
From this DNA sequence DNA: 3’ TACAGTCTGTAGCGTACATTATCGTGACCGACT 5’, change the third base in codon 4 to show missensemutation. Rewrite the resulting DNA sequence below and encircle the base that you changed.DNA:mRNA:polypeptide chain:Identify the type of base pair substitution that you applied in codon 4
Answer the following 2 questions based on the given sequence of DNA. The top strand is the template strand: 5’-CGTATAGCTCAGGGCGCTAACCTTAGCATGGACG-3’ (Template) 3’-GCATATCGAGTCCCGCGATTGGAATCGTACCTGC-5’ (Coding)
Which of the following are TRUE for RNA compared to DNA? Please select ALL correct answer options. Select 4 correct answer(s) Question 6 options: RNA contains the bases A, G, C, and U, whereas DNA contain the bases A, G, C, and T. RNA can catalyze biological reactions, but DNA cannot. DNA but not RNA can bind proteins RNA has ribose sugar in its nucleotides, rather than the deoxyribose found in DNA. RNA is usually single stranded and can make more complex three-dimensional molecular shapes than double-stranded DNA.
The Bacteria Escherichia coli DNA genome has a molecular mass of about 3.1 X 109 In your answers, show how you came up to each result? How many full double-helical turns does this DNA contain?
Let’s return to your patient with sickle cell anemia. Below is the RNA sequence from your patient and from her mother. (The ••• represents another 30 nucleotides not written out here). The affected nucleotide is indicated in BOLD. Patient’s RNA: 5’ –CUAUGACAGAGUUC•••CAUUAGCCA – 3’ Mother’s RNA: 5’ –CUAUGACAGUGUUC•••CAUUAGCCA – 3’ A) Write out the first 10 nucleotides corresponding to the DNA sequence of the coding strand for your patient in the 5' to 3' direction. B) From the information you have been given, why is it not possible to accurately write out the DNA sequence as it would really be found in the genome? (ie, what you wrote down in part A is NOT necessarily what the DNA sequence would really look like if we could examine the chromosome directly - why? And no this has nothing to do with the 30 nucleotides that aren’t written out or the mutated base). Your answer should be 1-2 sentences maximum.
Use the following information to answer the next two questions.A DNA antisense strand contains the following nucleotide base sequence:CGA TTT GGT TGAFrom this, what is the nucleotide sequence of the mRNA strand that is transcribed? a. AUG CCC UUG GUC b. CGT AAA CCA ACT c. AUC GGG UUG GUC d. GCU AAA CCA ACU