Second, in the answer blanks below, insert the names of the four primary tissues arising from each of the numbered regions (one or more of the germ layers), as indicated by the brackets on the diagram. Ectoderm (layer of columnar-shaped cells) O Mesoderm (layer of loose, migrating cells) 1. 2. Lan 2000 Figure 4.5 3. Endoderm (layer of cuboidal-shaped cells) Amnion Body stalk Yolk sac of embryo

Q: Punnett square

A: Punnet square: It is defined as the graphical representation or square diagram which is used to…

Q: For each question, choose the cell drawing(s) from those labeled A to P that best meets the listed…

A: During prophase, the mitotic spindle also starts to form. Microtubules gradually build up between…

Q: Simplify that answer please

A: Introduction  COVID-19 (Coronavirus Disease 19) is a highly infectious respiratory illness caused by…

Q: Describe the levels of organisation within the human body

A: The cell is the first level of organisation in the human body. Organs are formed from tissues, which…

Q: In humans, the alleles for blood type are designated IA (A-type blood), IB (B-type blood) and i…

A: The inheritance of blood types in humans is determined by alleles. Different combinations of alleles…

Q: ASAP, PLEASE ANSWER ALL THE SUBQUESTIONS TO GET A LIKE. TRUE OR FALSE? Even though steroids have…

A: Even though steroids have different structure compared to triacylglycerols, it is still…

Q: A 16-square Punnett is time-consuming to draw out. Dr. Thompson can  easily solve this problem by…

A: Genetics is the study of heredity and variation in living organisms. It involves the investigation…

Q: A. Draw. Use the information shown below to construct a cladogram for some of the organisms.

A: Introduction :- A cladogram is a diagram used in evolutionary biology to represent the evolutionary…

Q: Complete each statement by dragging each label into the appropriate blank. gain 2.0 hypotonic expand…

A: Introduction  Tonicity is a term used in biology to describe the relative concentration of solute…

Q: According to the endosymbiotic theory, which of the following is NOT true about the evolution of…

A: Because of specialized organelles, eukaryotic cells are more complicated than prokaryotic cells. All…

Q: What is shown in the image above? O needle-like leaves that fused O one doubly compound leaf Omany…

A: The image above shows a sample of foliage from a plant. It is composed of several needle-like leaves…

Q: INSTRUCTION: - Answer the question properly - Discuss your answer - Do not copy in Google or here in…

A: The following question asks for a description of a hypothetical fossil of a whale skull and its…

Q: The carbon cycle is nature’s way of reusing carbon atoms, which travel from the atmosphere into…

A: The carbon cycle is a natural process that involves the exchange of carbon between the atmosphere,…

Q: A researcher would like to determine how much influence genes have on the development of traits.…

A: A genetic research is a kind of study of the genes and its function which helps to determine certain…

Q: Dr. Joyce Poole and her research team also conduct studies in Gorongosa National Park in Mozambique…

A: Phenotype refers to the physical expression or traits of an organism. The phenotypic frequency is…

Q: Design and describe an experiment using celery stalks to demonstrate how certain conditions will…

A: A hypothesis is an assumption formed based on evidence. This is the first step in any investigation…

Q: Riann and Raul are soon-to-be biological parents who are both brown-haired, which reflects a…

A: Answer and Explanation :  Given that, Riann and Raul both have brown-hairs, which reflects a…

Q: For each of the following statements regarding protein import into mitochondria, indicate whether it…

A: Mitochondria are double-membraned bound organelles seen inside the cell. They are the site of energy…

Q: Q: In a certain species of plants, violet flower color (V) is dominant over white flower color (v).…

A: The Hardy-Weinberg Equilibrium presents an equation that may be used to compute allele frequencies…

Q: Types of substance transports through the membrane: secondary active transport (mechanism and…

A: Introduction :- Secondary active transport is a type of transport across biological membranes that…

Q: In hamsters, black fur (B) is dominant over brown fur (b) and long fur (L) is dominant over short…

A: Probabilities are calculated in genetic analysis to determine the likelihood of a specific trait or…

Q: The enzyme amylase will affect the breakdown of carbohydrates, but it will not affect the break-…

A: The body system is the network of organs and tissues that interact and depend on one another to…

Q: 3. What is the concentration of a stock solution in mg/ml and µg/ml if the total concentration was…

A: 3) The following question asks to calculate the concentration of a stock solution in milligrams per…

Q: and decomposition According to the te at sequester carbor include carbon di

A: Introduction: The carbon cycle is a critical aspect of Earth's ecosystem, as it regulates the amount…

Q: 5 1. Based on the data you collected, which are larger: bacteria (represented by E. coli) or…

A:

Q: What events in a neuron membrane occur slowly when threshold potential is reached?   Opening of K+…

A: Introduction: The nervous system is the complex network of nerves and cells that transmit signals…

Q: Malignant hyperthermia More than one answer mayy be correct. Question 8 options:   can by…

A: Malignant hyperthermia is a genetic disorder which follows autosomal dominant inheritance pattern.…

Q: If a culture of E. coli you are tracking grows from 5 x 103 cells/ml to 9 x 107 cells per ml in 4…

A: E Coli:   In the lower intestine of warm-blooded organisms, Escherichia coli, also known as E. coli,…

Q: 5’ GGACCTATCAAAATCCTTAATGCGCTAGGATAGCTAACGCATCCAC3’ The template strand is shown. The +1…

A: DNA and RNA govern transcriptional activity or the mechanism by which a gene's information is used…

Q: In rabbits, white coat color (CW) and black coat color (CB) are codominant, and both of these…

A: The study of the distribution of various genetic variations (genotypes) in a population is known as…

Q: Which of the following is NOT true of transfer RNA (tRNA)? Each individual molecule of tRNA can…

A: Introduction  tRNA (Transfer RNA) is a type of RNA molecule that plays a crucial role in the process…

Q: How do mitosis and meiosis differ? Q 15 of 15 Meiosis occurs as sex cells reproduce and engage in…

A: Mitosis and meiosis are the two processes through which cells divide and reproduce. Meiosis produces…

Q: Which of the following represents the correct order of the phases of mitosis?

A: A cell's growth and division are accompanied by a series of processes known as a cell cycle. A cell…

Q: what is an aquatic imsect order where adults and larvae are aquatic

A: Insects that can survive and even thrive in watery environments like lakes, ponds, and rivers are…

Q: Why do traits with a higher heritability tend to evolve faster? Unlike monogenic traits,…

A: Note :- Since you have asked multiple questions im only answering the ist 3 as per bartleby…

Q: Mendelian genetics

A: Biological inheritance: The process of passing of characters from parent to the offspring (i.e.,…

Q: The primary sweetener in Choc Zero Keto bark

A: Sweeteners are the additive artificial or naturally derived substances used as substitutes for sugar…

Q: muscle differs from skeletal muscle in: (more than one answer may be correct) Question 6 options:…

A: Smooth muscle are involuntary muscles where as striated muscles are voluntary muscles. Involuntary…

Q: The main sweetener in Mackies Honeycomb is _______________

A: A sweetener adds sweetness in the product in which it is added. It may be of two types natural…

Q: How does DNA bending protein relate to transcription?

A: Introduction: Binding to their recognition site, a growing number of transcription factors from…

Q: Explain why the phenotypic frequency of the tuskless trait is increasing in the African elephant…

A: The change in the character of an organism over generations is called evolution. The evolution of…

Q: Stems bend towards the light because____ migrates to the dark side of the stem. phototropin…

A: The ability of plants to use light as an energy source for photosynthesis is referred to as…

Q: Explain how oxidation of a substrate proceeds without oxygen.

A: “Since you have posted multiple questions, we will provide the solution only to the first question…

Q: In what ways do steroid hormones differ from peptide hormones? More than one aswer may be correct.…

A: 12.Hormones are chemical messengers of low molecular weight which are released in very trace amounts…

Q: If a healthy individual (without diabetes I or diabetes II) is given an insulin injection, what…

A: Insulin is a hormone secreted by pancreas which play an important role in regulation of blood sugar…

Q: Many biochemical reactions are non-spontaneous but are required for living organisms. How can they…

A: Chemical processes known as "biochemical reactions" happen within the cells of living beings. The…

Q: population of 600 scorpions was split into four populations when irrigation canals were built…

A: Introduction: The location or type of environment in which an organism lives and develops is…

Q: A- B C D E- Prokaryotic Cell Structure -F 4041 -G -H Match the prokaryotic cell structure to the…

A:

Q: T F T F T T F F The major bonds in cellulose are a(1-4) bonds. Answer: During mRNA splicing, U2…

A: Introduction :- mRNA splicing is a post-transcriptional process in which introns (non-coding…

Q: Using the figure below for the areas labeled "1" give the name of the axis Yaw and what it controls…

A: The motion of fish has six degrees of freedom because the movement along each of the three axes is…

Dissection

Dissection is the process of cutting up the tissue of a dead or live animal or plant, to do anatomical studies and surgical treatments. The purpose of dissection is to learn more about the overall structure of organs and organ systems and thereby understand the physiology of the organism.