Answered: Select the sequences relevant to…

Select the sequences relevant to eukaryotic translation AGGAGG (Shine-Dalgarno sequence) AUG start codon TATAA/TAAR (TATA box) at -30 TATAAT at -10 TTGACA at -35 A/GNNAUGG (Kozak sequence)

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter9: Gene Expression And Gene Regulation

Section: Chapter Questions

Problem 16QP: Given the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also,...

See similar textbooks

Related questions

Q: The next several questions refer to the data given in this problem. You sample a population of…

A: The prevalence of a gene variant in a population is represented by the allele frequency. Alleles are…

Q: 1. You are a lead engineer in a cGMP facility that develops and delivers tissue engineering…

A: Globally, myocardial infarction (MI) is one of the leading causes of death. Loss of cardiomyocytes,…

Q: Antibodies are found: O OOOO in the blood plasma on white blood cells in fibrinogen on red blood…

A: Antibodies are the proteins molecules that are synthesized by the B cells in the blood in response…

Q: How do you differentiate a nodule from a root gall?

A: Abnormal outgrowths of plant tissues and can be caused by nematodes is gall and nodule is formad by…

Q: UCUGAUGGGCUUU... Beginning with the Start codon (for Met), which amino acids, in order, are coded…

A: The correct answer is option b. methionine, glycine, phenylalanine Here, we are given the mRNA…

Q: What is one important advantage of using environmental DNA (eDNA), instead of traditional…

A: The environmental DNA methodology provides a number of benefits over conventional surveying…

Q: Your short answer should be 2-5 sentences depending on the question. (Ch. 55). Please answer both…

A: Most ecosystems have only 3 or 4 trophic levels. Some believe that humans should consume plants…

Q: Why sex? The comparison of parthenogenic species with sexually reproducing species demonstrates a…

A: The "life history" of an individual organism comprises important events linked to its growth,…

Q: If I set up a Chi square analysis and determine that I cannot reject the null hypothesis based on my…

A: When the sample sizes are large, a chi-squared test is a statistical hypothesis test used in the…

Q: the relationship of knee height and arm span between standing height?

A: Arm span also referred as "wingspan" is described as the physical measurements of length from one…

Q: Glycolysis occurs in what part of the cell? O eukaryotes: inner membrane of mitochondria;…

A: Glycolysis is a sequential process of breakdown of glucose in the presence of oxygen to synthesize…

Q: Using techniques described in this chapter, how could you determine whether Archaea exist in the…

A: Introduction Archaea are single-celled microorganisms that are structurally same as bacteria.…

Q: the human eye that contribute to its ability to capture images of the real world.

A: Eyes are the visual organs. The eyes of most vertebrates are placed laterally upon the head,…

Q: Bacterial DNA Process 1 Process 2 C. Human DNA a. Process 1: Restriction enzyme Process 2: Ligase…

A: Recombinant DNA technology is a method by which jeans are combined from two different sources in…

Q: For each experimental set up (geotropism and phototropism), identify the dependent and independent…

A: In an experiment the independent variable is the cause and the dependent variable is the effect. The…

Q: Explain how ALS leads to physiological symptoms

Q: Describe the changes in the brain that lead to the excess dopamine activity and the behavioral…

A: A condition that impairs a person's capacity for clear thought, feeling, and behavior. It may…

Q: Use the following information to answer the next question. Small Segment of DNA Uracil Adenine 2…

A: DNA and RNA are the nucleic acid.The monomers of nucleic acid is the nucleotides.Nucleotide is…

Q: Describe the structure and composition of viruses. What are three reasons that they are different…

A: In nature there are many ultra microscopic particles known as viruses. A virus is small particle…

Q: http://www.treeboss.net/tree-trunk-splotches.htm downloaded 21 March 2012 Q12. What do you think it…

A: This activity is about different types of living beings which have different characteristics such as…

Q: Summarize the following in concise and understandable language.

A: SARS-CoV-2 It is Severe acute respiratory syndrome coronavirus 2 which is a strain of coronavirus…

Q: What causes ALS (i.e. mutation, chromosomal alterations, epigenetics, other)?

A: Amyotrophic lateral sclerosis(ALS) An estimated 5 to 10 percent of ALS cases are familial, meaning…

Q: Explain how is the rasberry is related to strawberry, banana and grape?

A: Pollen is a plant's male reproductive cell. It results in the development of edible fruits and seeds…

Q: The amount of sodium in Bowman's capsule is determined by: A. Intracellular [Na] OB. Extracellular…

A: At the level of Bowman's capsule, amount of sodium will be only determined by the extracellular…

Q: Which of the following could not be used a a host cell receptor for viral entry? a.) LPS on…

A: What is a host cell receptor for viral entry? Each host cell carries specific biomolecules, known as…

Q: From the following DNA strand: AAGCTAGGATTGCC How many codons would be present?

A: A codon is made up of three nucleotides. Such codons are abundant in messenger RNA and consist of a…

Q: Which of the following statements is not true about heritability? a. H^2 is always a number between…

A: Estimation of a trait's heritability is particular to one population in a particular setting, and it…

Q: Q1.16. Suppose an entire village from a very wet region of Africa escaped mosquitoes by moving to an…

A: We all know that some genetic diseases are less prone to some diseases in which mosquito plays a…

Q: In a population of 643 mice, 124 had white coat colour (a recessive trait) while the rest had black…

A: Random mating occurs when individuals in a population mate with other individuals in the population…

Q: What is the purpose of the confirmed test in an experiment designed to test for coliform bacteria?

A: Coliform bacteria are either nonmotile or motile, Gram Negative, bacilli bacteria. These are found…

Q: Which of the following hypothetical islands would likely have the greatest species richness?

A: Biodiversity, often known as biological diversity, refers to the variety of life that can be found…

Q: What are the behaviors that need to be changed? What health promotion actions would help?

A: ANSWER) As the lady is diagnosed with osteoporosis therefore the most important changes which should…

Q: 5. A patient receives a donor kidney to replace diseased kidney tissue. Consider and answer the…

A: Cytotoxic T cells * MHC restricted * Antigen specific *Belong to adaptive immunity * Requires…

Q: Match the following events with the stages in mitosis

A: Cell division is a metabolic phenomenon in takes place inside the living cell in which parent cell…

Q: Which of the following statements best characterizes genetic diversity in humans? 1.) There are far…

A: Introduction:- Biological diversity is defined as the various different types of life or living…

Q: The principles of biomimicry and bioinspiration have been used to design and to engineer…

A: To cope with the complexity of the body and to evade the multiple layers of defense that tissues and…

Q: A blood sample is drawn in NaCitrate. The platelet count on an automated instrument is 305,000/UL.…

A: A platelet count from blood drawn into a sodium citrate tube is multiplied by 1.1 to account for the…

Q: What color is the alpha gene spot on the microarray? Answer: Yellow please explain why is the…

A: The microarray can be described as a lab-on-a-chip. It can be used to detect the expression of…

Q: Plant thermogenesis occurs when the inner membrane of chloroplasts have more thylakoids and stop…

A: The interior layer of membranes of chloroplasts, known as thylakoids, provide a foundation for the…

Q: Briefly describe two important functions of the 5’ methyl guanine cap on eukaryotic mRNAs.

A: In eukaryotes, the nascent RNA that is synthesized by RNA polymerase II is called hnRNA…

Q: Can you help me? Thank you- Chloroplasts in eukaryotes are similar to cyanobacteria in that: There…

A: Chloroplast are plant organelles which contain chlorophyll and help in photosynthesis Structure of…

Q: which of the following is a source of possible bias against minoritized people in genome wide…

A: For GWAS, thousands of people are required because the majority of genetic effects found for…

Q: How many Illumina clusters would you need to generate 15X coverage of the human genome, assuming…

A: Formula: C=LNG C stands for coverage G is the haploid genome length L is the read length N is the…

Q: The following data shows bisulfite sequencing results for a small region of the genome. How many…

A: The process by which the methyl groups are added to the DNA is called the DNA methylation.…

Q: Movement is a type of response to stimuli. Many unicellular organisms can move in response to…

A: Stimuli is an external input to a living organism, such as a sight, sound, smell, or touch, which…

Q: Targeted metagenomics is helping researchers better understand the complex connectios between diet,…

A: As we can see in the pie charts that Bacteriodetes make 35.44% in patients without cekiac disease…

Q: minimum edit distance

A: The minimum edit distance between two strings is defined as the minimum number. of editing…

Q: Explain why infections caused by fungi, protozoans, and helminths are more difficult to treat than…

A: Introduction : Infection is the entry of the pathogen or infectious agent that causes the disease…

Q: Use the following information to answer the next question. Life Cycle of a Butterfly Adult…

A: Nondisjunction in meiosis II comes from the failure of the sister chromatids to split during…

Q: In mammals, individuals with two X chromosomes usually de-activate one of the X chromosomes inside…

A: The cell has two kinds of chromosomes. These are sex chromosomes and autosomes. There are two sex…

Concept explainers

Genomics

Genes are responsible for transmitting the characters located on the chromosomes from one individual to another across the generations. Genetics is the study of different genes that are involved in different functions. Genetics is a branch of biology that studies genes, genetic diversity, and heredity in living organisms. The genetic system consists of genetic notations, which is a system of signs and symbols. Genotype refers to the organism's genetic composition, and phenotype refers to the observable property of the organism.

Question

E21.

Select the sequences relevant to eukaryotic translation
AGGAGG (Shine-Dalgarno sequence)
AUG start codon
TATAA/TAAR (TATA box) at -30
TATAAT at -10
TTGACA at -35
AGNNAUGG (Kozak sequence)

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Given the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also, write out the amino acid sequence of the protein encoded by this message. tRNA: UAC UCU CGA GGC mRNA: protein: How many hydrogen bonds would be present in the DNA segment?
The 5′ sequence for the mRNA for E. coli ribosomal L10 protein is shownbelow. Identify the Shine–Dalgarno sequence and the initiator codon.5′¬CUACCAGGAGCAAAGCUAAUGGCUUUA¬3′
The following DNA nucleotides are found near the end of a bacterial transcription unit. 3′–AGCATACAGCAGACCGTTGGTCTGAAAAAAGCATACA–5′ Q. Draw a diagram of the RNA that will be transcribed from this DNA, including its nucleotide sequence and any secondary structures that form.
The flu virus maximizes the use of its limited (13.5 kb) genome by using alternative translation initiation sites, overlapping reading frames, and ribosomal frameshifting. For example, part of the viral PA gene includes a rarely used CGU codon. When the ribosome pauses to translate this codon, it may slip ahead by one nucleotide and produce a polypeptide with a diff erent C-terminal sequence. From the partial mRNA sequence shown here, determine the normal polypeptide sequence and the sequence with the frameshift.
Template strand of DNA is: 3’ TACATAACCGGGCCCATATCGGCCATTTGC5’. 2a). Following transcription, what is the total number of codons in the mRNA transcript? 2 b). Where is the start codon located in this mRNA transcript? 2c). Following translation of this mRNA transcript, how many amino acids will the proteincontain and identify the amino acids sequence of this gene from a genetic code table*.*Note= using a genetic code table
With in vitro translation of an RNA into a polypep-tide chain, the translation can begin anywhere along the RNA molecule. A synthetic RNA mole-cule has the sequence 5'-CGCUUACCACAUGUCGCGAAC-3'. How many reading frames are possible if this molecule is translated in vitro? How many reading frames are possible if this molecule is translated in vivo, in which translation starts with the codon AUG?
Arrange the following components of translation in the approximate order in which they would appear or be used in prokaryotic protein synthesis: 70S initiation complex 30S initiation complex release factor 1 elongation factor G initiation factor 3 elongation factor Tu fMet-tRNAi fMet
Given the following mRNA sequence: 5-AUCCCGUAUGCCCGGGAGCUAGCCCAGC-3 a) Label the first condon, the stop codon, the untranslated regions and predict the amino acid sequence of the polypeptid
A normal mRNA that reads 5’ – UGCCAUGGUAAUAACACAUGAGGCCUGAAC– 3’ has an insertion mutation that changes the sequence to 5’ -UGCCAUGGUUAAUAACACAUGAGGCCUGAAC– 3’. Translate the original mRNA and the mutated mRNA, and explain how insertion mutations can have dramatic effects on proteins. (Hint: Be sure to find the initiation site.)
Arrange the following components of translation in the approximate order in which they would appear or be used in prokaryotic protein synthesis: 70S initiation complex 30S initiation complex release factor 1 elongation factor G initiation factor 3 elongation factor Tu fMet-tRNAifMet
From this overall anticodon sequence in tRNA, 3'-CAUCGGAAUAGAUCGCUAGUGGCAGGCAUAAUGAUCACCGGUCUGAGAAAAGUGGUACAUAUCAAC-5' What is the amino acid sequence that will be coded for using THREE-letter amino acid code starting from N-terminus to C-terminus.
identify start/end site, which amino acid will be on the tRNA that is the first to bind to the A site of ribosome, anticodon on the tRNA in the P site of the ribosome when release factor bings to A site, and what amino acid sequence of the protein that will be formed from mRNA? Here is the mRNA sequence:5'GUUUCCCGUAUACAUGCGUGCCGGGGGCCCGUUACCAGGCCUCAUUAUUGGAUAACGGAAAAAAAAAAAAA3'