Shown below is a drawing showing the result of an experiment in which an RNA molecule is allowed to mix with genomic DNA that has been denatured by boiling, and the two molecules are allowed to hybridize. The DNA strand is presumed to be the lighter-shaded one on the top. Note that only one strand of DNA is shown. This result was the first evidence for which of the following processes? a Replication b Transcription c Translation d Splicing

Shown below is a drawing showing the result of an experiment in which an RNA molecule is allowed to mix with genomic DNA that has been denatured by boiling, and the two molecules are allowed to hybridize. The DNA strand is presumed to be the lighter-shaded one on the top. Note that only one strand of DNA is shown. This result was the first evidence for which of the following processes? a Replication b Transcription c Translation d Splicing

Biology 2e

2nd Edition

ISBN:9781947172517

Author:Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:Matthew Douglas, Jung Choi, Mary Ann Clark

Chapter17: Biotechnology And Genomics

Section: Chapter Questions

Problem 1VCQ: Figure 17.7 You are working in a molecular biology lab and, unbeknownst to you, your lab partner...

See similar textbooks

Similar questions

A person with a rare genetic disease has a sample of her chromosomessubjected to in situ hybridization using a probe that is known to recognize band p11 on chromosome 7. Even though her chromosomes look cytologically normal, the probe does not bind to this person’s chromosomes. How would you explain these results? How would you use this information to positionally clone the gene that is related to this disease?
Below is a sample of a segment of DNA…(copy from left to right) 3’ TACAATGGGCGACGCGCTTCGTTTCAGATT 5’ 5’ ATGTTACCCGCTGCGCGAAGCAAAGTCTAA 3’ 1.Assume the 6th amino acid is changed from T to G on the DNA template strand. What type of mutation is this? What effect would this have on the protein? Look up an example for this type of mutation. 2, Assume the 5th and 6th amino acids are removed from the DNA template strand. What type of mutation is this? How would this affect the protein? Look up an example of this type of mutation. 3.Which mutation changes the protein more...a point mutation or a frameshift mutation. Explain your reasoning. 4.What would be the problem if ATT was inserted into the DNA template strand after the second codon? (Be sure to consult the coding chart for amino acids). 5. What if the second amino acid was repeated over 5Ox. What amino acid is repeated? What type of mutation is this? If this is on chromosome 4, what genetic disorder is this?…
Is each of the following mutations a transition, transversion, addition,or deletion? The original DNA strand is 5′–GGACTAGATAC–3′(Note: Only the coding DNA strand is shown.)A. 5′–GAACTAGATAC–3′B. 5′–GGACTAGAGAC–3′C. 5′–GGACTAGTAC–3′D. 5′–GGAGTAGATAC–3′
The sequence below shows the ends of one strand of a linear chromosome, with slashes representing the middle part, which is not shown. During replication of this one strand, on which side of the slashes will Okazaki fragments be made in the newly synthesized strand? 5' AGCCGTACGGTTATCTCCTAG //// GGGCCTATTGTGACCAGTGAGTCG 3' a) Both sides b) Neither side c) The right side d) The left side
The diagram illustrating the polymerase chain reaction (PCR) technique is provided below. How does the number of copies of the DNA region being amplified change at the end of each cycle of the polymerase chain reaction? Group of answer choices a. The number of copies triples (or triplicates). b. The number of copies does not change. c. The number of copies quadruples (or quadruplicates). d. The number of copies doubles (or duplicates). e. The number of copies halves.
Assuming DNA replicates semi-conservatively, which of these most closely approximates what you would see after one generation if you were to perform the Meselson-Stahl experiment? one band two bands three bands
A small section of bacterial DNA template (antisense) strand has the following nucleotide sequence: CGA AAA GAG AAT A mutation in the above sequence involved a substitution of a single base, resulting in an incomplete protein due to a nonsense mutation. Which of the following gen sequences exemplifies the mutation described above? a. CGA UAA GAG AAT b. CGA AAA AAG AAT c. CGA AAA GAG ACT d. UGA AAA GAG AAT
A small section of bacterial DNA template (anti-sense) strand has the following nucleotide sequence: GTT GTG ACG TAA A mutation in the above sequence involved a substitution of a single base, but did not affect the protein produced when the gene involved was transcribed and translated. Which of the following gene sequences could have the mutation described above? a. GTT GTG ACA TAA b. GTT GGG ACG TAA c. GTA GTG ACG TAA d. GTT GTG ACT TAA
A bacterial transformation is performed with a donor strain that is resistant to four drugs, A, B, C, and D, and a recipient strain that is sensitive to all four drugs. The resulting recipient cell population is divided and plated onmedia containing various combinations of the drugs. The following table shows the results.a. One of the genes is distant from the other three, which appear to be closely linked. Which is the distant gene? b. What is the likely order of the three closely linked genes
In the DNA model, what are the features that contribute to the stability and the ability of the DNA to replicate faithfully?
Consider the experiment conducted by Meselson and Stahl in which they used 14N and 15N in cultures of E. coli and equilibrium density gradient centrifugation. Draw pictures to represent the bands produced by bacterial DNA in the centrifuge tube before the switch to medium containing 14N and after one, two, and three rounds of replication in that medium. Use separate sets of drawings to show the bands that would appear if replication were (a) semiconservative; (b) conservative; (c) dispersive.
All of the following statements about telomerase are correct except: A. the RNA component acts as a template for the synthesis of a segment of DNA. B. it adds telomeric repeats to the 5'-ends of the DNA strands. C. it provides a mechanism for replicating the ends of linear chromosomes. D. it recognizes a G-rich single strand of DNA E. it is a reverse transcripcase.