Table 1. The Genetic Code: Codons and Their Amino Acids First Two Nucleotides of Codons Last Nucleotide of Codons The Amino Acids UU phe phe leu leu Abbreviations Names UC gly glycine ser ser ser ser ala alanine UA tyr tyr term term val valine UG cys cys term trp ile isoleucine CU leu leu leucine leu leu leu ser serine CC pro pro pro pro thr threonine CA his his gin gin pro proline asp aspartate glutamate lysine arginine CG arg arg arg arg glu lys AU le ile ile met AC thr thr thr thr arg asparagine glutamine cysteine methlonine asn AA lys lys asn asn gln AG ser ser arg arg cys met GU val val val val trp phe tryptophan phenylalanine tyrosine histidine GC ala ala ala ala tyr his GA asp asp glu glu G gly gly gly gly term termination lee Table 1 to read the codone bel w Find the na me of th e amin o acid and writ the space provided If

Table 1. The Genetic Code: Codons and Their Amino Acids First Two Nucleotides of Codons Last Nucleotide of Codons The Amino Acids UU phe phe leu leu Abbreviations Names UC gly glycine ser ser ser ser ala alanine UA tyr tyr term term val valine UG cys cys term trp ile isoleucine CU leu leu leucine leu leu leu ser serine CC pro pro pro pro thr threonine CA his his gin gin pro proline asp aspartate glutamate lysine arginine CG arg arg arg arg glu lys AU le ile ile met AC thr thr thr thr arg asparagine glutamine cysteine methlonine asn AA lys lys asn asn gln AG ser ser arg arg cys met GU val val val val trp phe tryptophan phenylalanine tyrosine histidine GC ala ala ala ala tyr his GA asp asp glu glu G gly gly gly gly term termination lee Table 1 to read the codone bel w Find the na me of th e amin o acid and writ the space provided If

Biology Today and Tomorrow without Physiology (MindTap Course List)

5th Edition

ISBN:9781305117396

Author:Cecie Starr, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Christine Evers, Lisa Starr

Chapter7: Gene Expression And Control

Section: Chapter Questions

Problem 1VQ

See similar textbooks

Similar questions

Most codons specify an _________ . a. protein c. amino acid b. polypeptide d. mRNA
Figure 28.41 gives some examples of recombination in IgG codons 95 and 96, as specified by the Vkand Jkgenes. List the codon possibilities and the amino acids encoded if recombination occurred in codon 97. Which of these possibilities is less desirable?
A certain mRNA strand has the following nucleotide sequence: 5AUGACGUAUAACUUU3 What is the anticodon for each codon? What is the amino acid sequence of the polypeptide? (Use Figure 13-5 to help answer this question.) Figure 13-5 The genetic code The genetic code specifies all possible combinations of the three bases that compose codons in mRNA. Of the 64 possible codons, 61 specify amino acids (see Figure 3-17 for an explanation of abbreviations). The codon AUG specifies the amino acid methionine and also signals the ribosome to initiate translation (start). Three codonsUAA, UGA, and UAGdo not specify amino acids; they terminate polypeptide synthesis (stop).
The AUC and AUA codons in mRNA both specify isoleucine. What feature of the genetic code explains this? complementarity nonsense codons universality degeneracy
From the given DNA base sequence indicated below: 5’’AGCCCATATGGCCCATACGCGGAATCGC 3’ Give the codon sequence and anticodon that will interact from the codon sequence Write the amino acids produced from the codon sequence.
I’m supposed to translate tRNA into amino acids for each codon of the previous question and state what the amino acid chains become. For example: AUG AAA CGC CCA....
The codon chart is shown below, what amino acid sequence does the DNA sequence: 3' TCAGCTAGA 5' code for?
Codons The genetic code consists of triplets of nucleotides called codons. Refer to the genetic code chart provided to answer the following questions. What is unique about the codon AUG? 2. What is unique about the codon UGA?
6a) Transcribe the following DNA sequence into codons. TACGCGACATTACATGAATCGTTTGGAGATTAGCCCTATTTCTCTAAGAACACGACTb) Excise(cut out) codons numbered 5, 6, and 7. Leave the remaining codons. c) Now translate the sequence . d) Explain how many amino acids are now in your polypeptide? e) What would happen to your polypeptide if either of your cysteine amino acids near the start or end of thepolypeptide were translated incorrectly. f) Based on your final polypeptide can you make the original DNA strand by doing reverse translation andtranscription? g) Explain if your polypeptide similar to your template strand or the complementary strand?
Use this genetic code table for some of the questions ahead. You do not need to memorize the code, except for the start codon (AUG = Met) and the stop codons (UAA, UAG, UGA). Which of the following statements about the genetic code is correct? A) All codons specify more than one amino acid. B) The genetic code is redundant. C) All amino acids are specified by more than one codon. D) All codons specify an amino acid.
On the mRNA codon table below, the first nucleotide in mRNA is to the left, the second is above, and third is to the right. On the sequence, the 5’cap is indicated by (5’). The poly (A) tail is not shown. Use the codon table to translate this short mRNA. Mark the codons and write the amino acid sequence beneath them. (5’)CGUUACAAUGUAUCGCGCGGUACUCGGCAAAGUGCCCUGAAUAGAGUUGGUA(3’) In a previous round of replication, DNA polymerase made a mistake and added a C on what is now the DNA template strand. In the space on the mRNA sequence below, write the added base. Mark the codons again and write the amino acid sequence beneath them. What do you observe? (5’)CGUUACAAUGUAU CGCGCGGUACUCGGCAAAGUGCCCUGAAUAGAGUUGGUA 3’
Look at Table 26.3 and find codons for the following amino acids:(a) Val (b) Arg (c) Ser