The coenzymes NAD+ and NADP+ are important electron carriers that pick up electrons from one pathway and deliver them to another. Below is a list of pathways or enzyme complexes that we have covered in class.  Indicate which coenzyme these pathways or complexes produce by writing NAD+, NADP+, NADH or NADPH in the blank provided.    ________ glycolysis ________ citric acid cycle ________ alcoholic fermentation ________ pyruvate dehydrogenase complex ________ gluconeogenesis ________ mitochondrial electron transport ________ photosynthesis light reactions ________ photosynthesis dark reactions

Q: The hydrolysis of a substrate, S, by an enzyme has been studied in the lab. The following initial…

A: Consider the reaction where a substrate 'S' is converted to its product 'P' by an enzyme. The rate…

Q: a. The first step in the pay-off phase of glycolysis is the oxidation of glyceraldehyde-3-phosphate…

A: Glycolysis is the pathway which breaks down glucose into two three-carbon compounds and also…

Q: Methylation. Amino acid decarboxylation. A Claisen reaction. Ketoacid decarboxylation. Aldehyde…

A: Methylation It is the most common but minor pathway as that of sulfonation. The cofactor used in…

Q: Glycolysis is an energy-generating pathway. How much of each of the following is produced when…

A: Glycolysis is the process in which one mole of glucose is oxidized to two moles of pyruvate. It…

Q: Which of the following is false? a. Methyl, phosphoryl, adenyl, uridylyl and adenosine diphosphate…

A: Enzymes are basically proteins that are intricately packed inside with the help of intramolecular…

Q: ACTIVITY 8.1.3 Complete the table Name and Structure of the attached molecule Sphingolipid Function…

A: Introduction: Sphingolipids are complex lipids that make up the second-largest class of…

Q: Predict the relative intensity and wavelength maxima for the given molecules and stated conditions.

A: Intrinsic fluorescence is observed due to three aromatic amino acid residues - phenylalanine,…

Q: Choose any/all that apply to lipids.

A: Lipids are biological macromolecules, insoluble in water/polar solvents but soluble in non-polar…

Q: E. How many nucleotides would be required to generate a polypeptide that is 15 amino acids long?…

A: The genetic code is a sequence of three-letter combinations of nucleotides called codons, each…

Q: intercalating agent

A: Intercalation is the process in which there is the insertion of molecules between the planar bases…

Q: Which of the following was used to extract DNA from the food products for the GMO lab? Ethanol…

A: DNA extraction is a technique to separate DNA from the given cell sample. It involves the steps…

Q: State those enzymes involved in tricarboxylic acid and explain each.

A: The tricarboxylic acid cycle (TCA cycle) is a common metabolic pathway located in mitochondrial…

Q: 135.) In the citric acid cycle, oxidoreductases are reversible. A) 0 of 4 B) 1 of 4 C) 2 of 4 D) 2…

A: The citric acid cycle oxidizes the acetyl Co-A into the carbon dioxide in the mitochondria. The…

Q: On the basic structure of fungi especially on the fungal cell membrane, what do you think are the…

A: Fungus is an eukaryotic organism that include yeasts, moulds, mushrooms etc. They are composed of…

Q: ACTIVITY 6.1 Complete the table below Source Example of Carbohydrate Function

A: Carbohydrates are a form of macronutrient that can be found in a variety of foods and drinks.…

Q: 4. The diagram below illustrates time dependent O₂ uptake by isolated skeletal muscle mito- chondria…

A: The mitochondrial respiration process involves the activation of the electron transport chain. The…

Q: f. Total number of net cytosolic ATP molecules produced right after glycolysis: g. Total number of…

A: The starch molecules obtained through the diet are degraded to form dextrins, maltose, and…

Q: Total Number of NADH Obtained from one Pyruvate Molecule Total Number of FADH2 Obtained from one…

A: In respiring bacteria pyruvate is further oxidized after it is transported into mitochondria that is…

Q: In normal mitochondria, which of the following is true for the rate of NADH consumption (oxidation)?…

A: Mitochondria occupy a significant part of the cytoplasmic extent of eukaryotic cells, and that they…

Q: Which of the following is an anomer of a-D-galactopyranose?

A: Anomers are cyclic stereoisomer , for example the C-1 of sugar molecule become chiral carbon and has…

Q: What are the respective functions of PSI & PSII PSI production of O 02 reduction of O NADP+…

A: In the light-dependent electron transport from water to NADP+ and the evolution of oxygen, both PS I…

Q: ADP molecules phosphate molecule intermembrane space ATP synthase H+ ions CoQ mitochondrial matrix…

A: A widely accepted model for ATP synthesis is the binding change mechanism or flip-flop…

Q: What is the diffusion coefficient of a membrane-bound protein of molar mass 79,300 daltons density…

A: Diffusion coefficient of the protein is measured as protein mass transfer with between the two…

Q: 2. Use your knowledge of amino acids (and the R groups) and tertiary structures of proteins to…

A: Sickle cell anemia is a inherited disorders due to defect in the gene. In this disease mutation…

Q: The reason for the increase in the rate of an enzyme reaction when the temperature is increased is…

A: The increase in the rate of Enzyme reaction is due to the increase in kinetic energy and the…

Q: 1. Name and draw diagrammatically the series of mitochondrial electron transfer catalysts, starting…

A: Since you have posted multiple questions we will answer the first question for you. If you want the…

Q: What is Therapeutic Drug Monitoring (TDM) and under what circumstances would it be considered for a…

A: Therapeutic drug monitoring (TDM) is commonly described because the medical laboratory size of a…

Q: A plant isolate was subjected to qualitative tests to determine the presence of macromolecules.…

A: Plant isolates are obtained from different tissue homogenate samples of plant parts. Usually, a…

Q: Discuss the four main mechanisms of antibiotic resistance and factors that promote the emergence of…

A: Antibiotic resistance occurs when microorganisms like bacteria and fungi develop the ability to…

Q: What are the different sections in the Clinical laboratory? Which one you think, will be your…

A: "Since you have asked multiple question, we will solve the first question for you. If you want any…

Q: 2. Cells often use the same enzyme reaction pattern for analogous metabolic conversions. For…

A: A metabolic pathway is defined as a group of actions along with the interactions that lies between…

Q: What is the difference between the first steps of DNA sequencing to PCR in terms of the number of…

A: PCR is expanded as a polymerase chain reaction. It is a technique that is used widely for the…

Q: A) For this DNA fragment "TGAATTCCCGGGTTCCGGGAATTCGCGCGAATTCCCGGTATA", what is its complementary…

A: Deoxyribonucleic acid (DNA) is a nucleic acid that carries genetic information from parent to…

Q: An unsaturated fatty acid produces more energy than the analogous saturated fatty acid. A) True B)…

A: Saturated fatty acids contain hydrocarbon chains that are only linked by single bonds. There are one…

Q: Monosaccharides can be obtained not only from dietary carbohydrates but other major sources include…

A: Monosaccharides is a one of the type of carbohydrate. Monosaccharides are also called as simple…

Q: The enzyme Glucose-6-phosphate dehydrogenase catalyzes the nicotinamide adenine dinucleotide…

A: Glucose-6-phosphate dehydrogenase enzyme belongs to the group of oxidoreductases. It catalyzes the…

Q: One treatment for hyperuricemia is administration of xanthine oxidase inhibitors like  allopurinol.…

A: Hyperuricemia means a high concentration of uric acid in the blood. Hyperuricemia results in gout…

Q: Which of the following was added to cell lysate to stabilize RNA molecules during the RNA…

A: RNA Extraction is the process of purification of RNA from biological samples. A Trizol Reagent is…

Q: Under anaerobic or hypoxic conditions, some organisms can transfer electrons from NADH to pyruvate…

A: The pyruvate formed as the product in the glycolysis has two fates. In the absence of oxygen, it…

Q: Which of the following is an anomer of a-D-galactopyranose? CHOH OH H. он он CH,OH OH он H он H H он…

A: Galactose is aldohexose. It is a C-4 epimer of glucose. The cyclic six-membered ring is called…

Q: Which is a characteristic of cooperative binding that is exhibite by a protein? O Momomeric…

A: Introduction: A macromolecule will show cooperative binding if its affinity for its ligand changes…

Q: What will be the effect of mutation that turns lysine to arginine

A: The mutations occur in genomic DNA but they will reflect in the form of protein sequence and…

Q: Which post-transcriptional modification is NOT shared by all eukaryotic RNAs?   a. Modifying bases…

A: Posttranscriptional modification is the process by which the RNA primary transcript is chemically…

Q: Use the data below to determine the maximum velocity [in mM/s] of a certain enzyme-catalyzed…

A: We must know the Michaelis Menten equation: V=Vmax [S]Km+ [S]

Q: (a) What is the difference between low-density lipoproteins (LDLs) and high-density lipoproteins…

A: Cholesterol is a chemical that the body produces naturally. Cholesterol is a component of cell…

Q: Which of the following monosaccharaides is a Hexose? Dihydroxyacetone phosphate (DHAP) Erythrose…

A:

Q: ased on the knowledge you gained from the cloning module, which of the lanes in the urs is…

A: Agarose gel electrophoresis is used to separate DNA molecules based on their size and analyze DNA…

Q: ATP constitutes the most common cellular energy currency. Explain the factors that account for the…

A: The human body comprises a trillions number of cells. Every cell comprises mitochondria. The main…

Q: Angiotensin-converting enzyme inhibitors (ACE inhibitors) are used to treat high blood pressure.…

A: ACE is an enzyme in the Renin-Angiotensin-Aldosterone pathway (RAAS).  ACE inhibitors (ACE I)…

Q: Properties of Body Fluids.

A: "Since you have posted multiple questions, we will answer the first question for you. If you want…

Metabolic pathways

Metabolism is defined as the group of life-supporting, enzyme-mediated chemical reactions in organisms. A metabolic pathway is a set of these chemical reactions that involve anabolism (synthesis of complex biomolecules) and catabolism (breakdown of biomolecules into small molecules) that occur inside a cell. Metabolites are the reacting substances, products, and intermediate substances of an enzymatic process that are altered by a series of chemical events catalyzed by enzymes.