70 Pre-initiation begins with either TFIIF or TATA binding protein binding to the core promoter. Yes or no 71 Exons tend to be non-conserved during evolution, whereas introns usually are conserved. Yes or no 72 Transfer RNA molecules fold into L-shaped three-dimensional structures. Yes or no

70 Pre-initiation begins with either TFIIF or TATA binding protein binding to the core promoter. Yes or no 71 Exons tend to be non-conserved during evolution, whereas introns usually are conserved. Yes or no 72 Transfer RNA molecules fold into L-shaped three-dimensional structures. Yes or no

Biology 2e

2nd Edition

ISBN:9781947172517

Author:Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:Matthew Douglas, Jung Choi, Mary Ann Clark

Chapter16: Gene Expression

Section: Chapter Questions

Problem 20RQ: A scientist mutates elF-2 to eliminate its GTP hydrolysis capability. How would this mutated form of...

See similar textbooks

Related questions

Q: <Homework 11 Problem 11.52- Enhanced - with Feedback TAILA Describe the structure of a plasmid. Drag…

A: Plasmid is small circular piece of DNA. It is present in bacteria.

Q: The patient complains about intense pain in the right iliac region, vomiting, and a fever of 38.5°…

A: When a simple appendectomy is performed to treat appendicitis, the vermiform appendix almost usually…

Q: 1. Determine what is the Cross section? What's under the numbers? 1 2

A: Anatomy The branch of science which deals with the structure of the organism.

Q: Describe the role of non-specific macrophages in preventing infection.

A: Non specific macrophages are immune cells tha respond to many antigens. It act as first line…

Q: What is the scientific process

A: Introduction Any system of knowledge concerned with the physical world and its phenomena that…

Q: QUESTION 16 Consider each of the three calculation problems related to DNA extraction. A. What is…

A: concentration = A260 * conversion factor * reciprocal of dilution factor Given: A260 = 0.40 ,…

Q: Listen to the video about the effects of smoking in our lungs using the link below.…

A: Introduction The respiratory system is a collection of organs and tissues that assist in breathing.…

Q: glucose and galactose

A: Glucose: Glucose is a simple sugar composed of C, H, and O atoms and tastes sweet. Galactose:…

Q: 2. What are differences between Gymnosperms and Angiosperms?

A: Gymnosperms are group of seed producing plants. eg : conifer , cycads etc Angiodperms are…

Q: Method: 1. 96 well plates are coated with an antigen. Sites unoccupied by the antigen are blocked…

A: We know that enzyme linked immunosorbent assays are sensitive technique that use an enzyme Ab-Ag…

Q: Kalabasa Sibuyas Bawang Cucurbita moschata Allium cepa Allium sativum Immatory

A: Given here are some plant ingredients ,following are their active substances and…

Q: What is the common name of the following? Euglena Foraminifera Plasmodium Paramecium Grantia

A: More than 1,000 species of single-celled, flagellated (i.e., bearing a whip-like appendage)…

Q: 2. How does the universality of the genetic code make the recombinant DNA technology possible?

A: A nucleic acid is a linear polymer of nucleotides that is a component of the cell's information…

Q: Which of the following statements accurately represents the difference between a gene and a locus?…

A: A gene is the most fundamental physical and functional element of heredity. DNA is the material that…

Q: Eukaryotic RNA polymerases can be distinguished by their sensitivities to ( ). 50 Each bacterial…

A: Eukaryotes have mainly three types of RNA polymerases that transcribes different types of RNA. RNA…

Q: The absorption for homogeneous tissue can be described by this equation: O 1 = lo e^(-X/D) O 1 = lo…

A: Biology is the study of cells, tissues, organs, organ systems, organisms, species, and communities…

Q: Cellular respiration connects the degradation of glucose to the formation of ATP, NADH and FADH2 in…

A: Cellular respiration is the process of utilizing oxygen and food molecules to create energy, carbon…

Q: SCIENTIFIC INQUIRY Scientists search the scientific literature using electronic databases such as…

A: The genetic basis of parental care evolution in monogamous mice - Published in the year 2017 and it…

Q: 32 A57-year-old woman is admitted to the hospital because of worsening headaches and altered vision.…

A: Homonymous hemianopsia is a condition in which a person can only perceive one side of the visual…

Q: You used agarose gel electrophoresis to separate DNA fragments of different size and the experiment…

A: Agarose gel electrophoresis is a method to separate, identify and purify the DNA molecules.…

Q: Which of the following is NOT a result of ectopic fat accumulation? a. Heart disease b. Fatty…

A: Introduction Body fat is a term that describes adipose tissue. It can be found in every part of the…

Q: 1. Give the plant source, scientific name of the plant source, and the type of fiber used in each…

A: Hemp, ramie, cotton, and flax are the most often utilised plants for garment production. Hemp Hemp…

Q: A true-breeding plant expressing a dominant phenotype is crossed with a true-breeding plant…

A: A true-breeding organism is homozygous for the gene under study and carries two copies of the same…

Q: In an anabolic reaction A. biological molecules are broken down and the Gibbs free energy…

A: Biological macromolecules are the molecule that are needed in more amount for the body. Major…

Q: Which of the following statements describes the multifactorial inheritance in genetics? Question…

A: Inheritance is the transfer of genetic traits from one generation to the next.

Q: . Describe and list the steps involved in DNA replication. 2.

A: DNA is a molecule made up of two polynucleotide chains wrapped around each other to form a…

Q: A synapse with all of these; a postsynaptic dendrite, an astrocyte end foot, and the presynaptic…

A: Introduction :- Synapses are part of the circuit that connects sensory organs in the peripheral…

Q: You test the ribosomes of an organism that you have found. You find that it has 80S ribosomes (think…

A: Introduction: Because they sediment quicker than prokaryotic (70S) ribosomes, eukaryotic ribosomes…

Q: Which condition would require an adjustment in the recommended intake of protein that differs from…

A: Recommended Dietary Allowances (RDA) are the levels of essential nutrients that on the basis of…

Q: Which of the following is found inside a eukaryotic cell, but is absent in a prokaryotic cell? a)…

A: All living bodies- plants, animals or microscopic organisms, are made up of cells. The term 'cell'…

Q: 6. What are the similarities and differences between the transcription process and the replication…

A: Replication A biological process of in which two identical copies of DNA are produced.

Q: 1. What is the active substance and activity/indications (e.g. antibacterial, anti-inflammatory) of…

A: Answer :- The phytocontents, inhibitor, and anti inflammatory activities of tomato…

Q: A Spleen B

A: The given pic shown is of the dissection of the male frog showing some part of the reproductive…

Q: Create a cladogram that includes of a panda, a species of bacteria, a species of protist, and 3…

Q: 1 laryngeal prominence 2 3 -4 eustachian tube lower jaw 6 5'

A: The given diagram shows the buccal cavity of a frog. The frog is an amphibian that belongs to the…

Q: 12:15 Acellus Types ionary Instructions : Choose one of the following: - Directional selection:…

A: Directional selection is a negative natural selection mechanism in population genetics in which an…

Q: Which of the following is NOT a reason for claims being denied?

A: All step 2 solution indicate that option 2 is correct Diminished Standard of Care

Q: Put the following levels of chromosome organization in order from least complex (least packaged…

A: The word chromosome arises from the Greek word chroma means color and soma which means body because…

Q: 2. Describe when the inflammation is good and when it is bad.

A: Introduction Inflammation is the body's natural response to infection. Few signs of inflammation are…

Q: Recombination mapping has been fundamental in studying the arrangement of loci along chromosomes.…

A: DISCLAIMER FOR MULTIPLE Since you have asked multiple question, we will solve the first question…

Q: DNA sequence data suggest that modern humans last shared a common ancestor with Old World monkeys…

A: Introduction Phylogenetics is a field of biology that investigates organisms' evolutionary…

Q: Name and in brief describe the process by which immunological diversity is generated ?

A: Introduction Antibodies can be induced by virtually all microorganisms. Antibodies must be diverse…

Q: Living organisms play an important role in the recycling of many elements within an ecosystem.…

A: Ecosystem balance, often known as "ecosystem homeostasis," is influenced by both factors that tend…

Q: Transcription

A: RNA polymerase synthesizes an RNA transcript complementary to the DNA template strand in the 5' to…

Q: 1. You make a recombinant plasmid vector that contains an insert of a gene you are interested in…

A: Gel electrophoresis separates the DNA on the basis of its size. The DNA is loaded on the well on the…

Q: What is the important function of the pentose phosphate pathway for microbial cells?

A: Introduction The pentose phosphate pathway is a metabolic process that proceeds in the reverse way…

Q: Calculate the work done by a student in lifting a 0.5 kg book from the ground and keeping it on a…

A: Introduction Work is a unit of measurement for the amount of energy consumed in moving an item. If…

Q: 46 What is the A-site of the ribosome? A. exit site b. aminoacyl-tRNA binding site c. peptidyl-tRNA…

A: Ribosomes are the protein factories of the cell. These are responsible for protein synthesis by…

Q: 5. For biological diversity, is mitosis or meiosis the more important process?

A: Mitosis and meiosis are processes of cell division used by various types of cells Mitosis is mainly…

Q: Explain how mutation, genetic drift, and gene flow can all contribute to changes in allele…

A: An allele is one of two or more versions of DNA sequence (a single base or a segment of bases) at a…

Concept explainers

Genetic Evolution

Sexual reproduction produces distinct population variations. Heredity determines the traits and qualities to be passed down to the progeny. Over time, this variation within-species is also affected by the process of human evolution. The study of how genetic variation leads to evolutionary changes is known as genetic evolution. If a trait helps an organism to survive and reproduce, it is more likely to be passed down the generations. It is rare that such traits result in a completely distinct set of traits in descendants than the ancestral population; this can result in the emergence of a new species.

Question

70
Pre-initiation begins with either TFIIF or TATA binding protein binding to the core promoter.

Yes
or
no

71
Exons tend to be non-conserved during evolution, whereas introns usually are conserved.

Yes
or
no

72
Transfer RNA molecules fold into L-shaped three-dimensional structures.

Yes
or
no

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Describe and explain the 3-D structural change to the protein (uniprotkb-p39086/gene regulator 5) upon initial binding.
The PIC is highly conserved among species, from yeast to humans. Why is the positioning of the first TFII protein so important for proper transcription of the gene?
88Sequential binding of RNA polymerase II-TFIIF complex, TFIIE, and TFIIH completes ___________________ formation. A.pre-initiation complexb.TF recognition elementc.pre-elongation complexD.TATA binding complex 89Which of the following is the GDP-GTP exchange protein?A.EF-Tub.none of the abovec.EF-TsD.EF-G 90RNA polymerase II has 14 subunits. Yesorno
82Transcription termination takes place downstream from the _______________. A.poly(A) siteb.promoter regionc.5'-m7 G capsD.enhancer sequences 83The core promoter element of RNA polymerase II extends from about 40 bp upstream of the transcription initiation site to about _______ bp downstream from this site. A.100b.1000c.40D.200 84Archaeal and eukaryotic ribosome structure appear to be different from the bacterial ribosome structure. Yesorno
73Dicer catalyzes Sequence-dependent single-stranded RNA cleavage. Yesorno 74Amino acid-coding regions within eukaryotic genes may be interrupted by ___________ regions. A.noncodingb.long terminal repeatc.split geneD.enhancer 75Which of the following cleaves the N-terminal methionine from polypeptides?A.Methionine isomeraseb.Methionine aminopeptidasec.Methionine carboxylaseD.Methionine transferase
A normal mRNA that reads 5’ - UGCCAUGGUAAUAACACAUGAGGCCUGAAC- 3’ has an insertion mutation that changes the sequence to 5' -UGCCAUGGUUAAUAACACAUGAGGCCUGAAC- 3’. Translate the original mRNA and the mutated mRNA, and explain how insertion mutations can have dramatic effects on proteins. (Hint: Be sure to find the initiation site.)
A scientist compares the promoter regions of two genes. Gene A’s core promoter plus proximal promoter elements encompasses 70bp. Gene B’s core promoter plus proximal promoter elements encompasses 250bp. Which of the scientist’s hypotheses is most likely to be correct? More transcripts will be made from Gene B Transcription of Gene A involves fewer transcription factors Enhancers control Gene B’s transcription Transcription of Gene A is more controlled than transcription of Gene B.
The a/a operon is an inducible operon that controls the production of the sugar arabinose. When arabinose is present in a bacterium it binds to the protein AraC, and the complex binds to the initiator site to promote transcription. In this scenario, AraC is a(n). activator inducer repressor operator
A scientist mutates elF-2 to eliminate its GTP hydrolysis capability. How would this mutated form of elF-2 alter translation? Initiation factors would not be able to bind to mRNA The large ribosomal subunit would not be able to interact with itiRNA transcripts tRNAi-Met would not scan mRNA transcripts for the start codon elF-2 would not be able to interact with the small ribosomal subunit.
5’ATCGCGCTAGGCGCATGCTACCTAGGCTATCTGCCTAGCTATCGACTAATCTGATCGAGTCAG3’ 3’TAGCGCGATCCGCGTACGATGGATCCGATAGACGGATCGATAGCTGATTAGACTAGCTCAGTC5’ Write out the pre-mRNA for this geneWrite out the mRNA for this geneHow many amino acids does this protein have? Translate the protein Label your 5’ and 3’ UTR’s
1. in a TATAT sequence, would the number of sequences similar to a promoter increase or decrease if variation occurred? 2. false promoters are segments that would bind to RNA polymerases but are not associated with genes. is it possible for false promoters to be found in the human genome?
a. Very few if any eukaryotic genes contain tractswith more than 25 As or Ts in a row, yet almost alleukaryotic mRNAs have a tract with more than100 As in a row. How is this possible?b. Scientists know the nucleotide sequences that directthe termination of bacterial gene transcription, butthey generally have little idea about the nature ofthe nucleotide sequences that direct transcriptiontermination in eukaryotic cells. Explain the basisof this statement.