The DNA can be increased in size by only about 5%, representing the addition of only 3 kb of new DNA. You are developing a cloning vector based on i bacteriophage (Figure 1). Which segment of the genes can be removed from the DNA to increase the ability to carry a larger DNA fragment? Explain your reason. (ii) How lambda DNA exists as a double stranded linear molecule during the infection cycle?
Q: Based on the picture, why plasmids are used as a vector for DNA Recombination? What other vectors…
A: Ans: Recombinant DNA technology: The given process is the process of recombinant DNA technology in…
Q: In Hershey-Chase experiment, bacteriophages protein coats were tagged with radioactive isotope S-32.…
A: Hershey and Chase's experiment was based on the principle to identify DNA as genetic material. they…
Q: Which of the following is NOT true regarding E. coli replication on the lagging strand? initially…
A: In molecular biology, DNA replication is the process of making two identical DNA molecules from one…
Q: The beta subunits of E.coli DNA polymerase III are responsible for its _______. A. ribosome…
A: In prokaryotes, the DNA replication is carried out with the help of various enzymes, like, DNA…
Q: With the use of well-illustrated diagrams, reconstruct the entire cloning process by explaining…
A: Molecular cloning is a method that includes insertion of “recombinant DNA” into a “vector” (carrier…
Q: For the chromatogram below, what is the sequence of the template DNA from base 115 to 125?…
A: According to the question, we have to answer the question that which is for the chromatograph below,…
Q: Why can’t a linear duplex DNA, such as that of bacteriophage T7, be fully replicated by just E.…
A: There are two replication systems present in organisms, namely linear DNA replication system and…
Q: In bacterial cells, nucleotide excision repair involves which of the following proteins? DNA…
A: The principal method utilised by mammals to remove bulky DNA lesions such as those caused by UV…
Q: What distinguishes topoisomerase type I from topoisomerase type II (“gyrase”) in E. coli bacteria?
A: Those in science which participate in overwinding aur underwinding of DNA are called topoisomerases.…
Q: In the diagram shown below representing a replisome, the portion represented by the letter functions…
A: Ans. The method of DNA replication is a process in which double-strand DNA molecule copying in order…
Q: Reiji and Tuneko Okazaki conducted a now classic experiment in1968 in which they discovered a…
A: The DNA (deoxyribonucleic acid) replication occurs in a semi-discontinuous manner. In this process,…
Q: Two pathways, homologous recombination and nonhomologous end joining (NHEJ), can repair…
A: Non-homologous end joining (NHEJ) is one important pathway in eukaryotic cells responsible for the…
Q: Bacteriophage lambda (λ) consists primarily of a head, which contains the genomic DNA, and a tail…
A: Answer: Bacteriophage are the bacteria infecting viruses, which are able to infect bacteria. These…
Q: Considering prokaryotes, what is the enzyme that helps hold DNA polymerase III in place when…
A: In prokaryotes, replication is a process by which it makes identical copies of DNA. The process…
Q: Restriction enzymes in bacterial cytoplasm cut injected bacteriophage DNA wherever certain sequences…
A: The genes are the hereditary unit of an organism. Specific nucleotide sequence of a gene causes the…
Q: Hello, can you help and explain to me what the difference between agglutination and coagulation? And…
A: Dna replication is the process of converting two parents strands of the double helical dna into two…
Q: A DNA probe with sequence TCAGGCTTCAG would bind most strongly to which of the following DNA…
A: Gene probes are small, single-stranded DNA or RNA that hybridize with the target DNA sequences in a…
Q: A particular variant of the lambda bacteriophage has a DNA double-stranded genome of 51,365 base…
A: DNA is a double stranded helical molecule that is made up of repeating nucleotides. The nucleotides…
Q: Match the following (most appropriate combinations): helicase Topoisomerase DNA Polymerase III DNA…
A: Deoxyribonucleic acid (DNA) is a polymer made up of two polynucleotide chains which wrap around…
Q: complimentary sticky ends
A: DNA's are cut by using restriction enzymes ( endonuclease or exonuclease) which produce sticky or…
Q: An RNA-dependent DNA polymerase that carries the RNA template with it to synthesize repeats at the…
A: Replication is the process of duplication of the DNA. Replication is initiated by recognizing the…
Q: The sequence below shows the ends of one strand of a linear chromosome, with slashes representing…
A: DNA is the nucleic acids present in the organisms. DNA is the deoxy-ribose nucleic acid in which…
Q: An E. coli Hfr (high frequency recombination) strain is defined as an E. coli strain that Select…
A: Bacteria reproduce via binary fission and splits into two identical daughter cells. Binary fission…
Q: Based on your knowledge of the COVID-19 genome (from question 6), what step(s) in the flow of…
A: Viruses are a nucleoprotein entity which is able to utilize the synthetic machinery of a living cell…
Q: which parts would a plasmid vector with 2500 bp have in E. coli
A: A plasmid is a small, circular, double-stranded DNA molecule that is distinct from a cell's…
Q: You are trying to clone you favorite piece of DNA into the PUC vector shown above. You've pulled an…
A: Joachim Messing and colleagues developed a variety of plasmid cloning vectors, including pUC19. The…
Q: Three common ways to repair changes in DNA structure are nucleotideexcision repair, mismatch repair,…
A: DNA repair, it is a mechanism by which a cell recognise, or identify the mutations, damage, or any…
Q: What similarities and differences exist in the enzymatic activities of DNA polymerases I and III?…
A: The process of replication in living cells requires a set of enzymes and DNA dependent DNA…
Q: You are cloning the genome of a new DNA virus into pUC18. You plate out your transformants on…
A: Introduction Blue-white selection is the method of screening of transformant colony from the…
Q: If the MJ helix in bacteriophage MS-2 is replaced with all Adenines on both strands, what would you…
A: A bacteriophage is a virus that is able to infect bacteria. Bacteriophage literally means "bacteria…
Q: Need help with question one
A: The plasmid is the extrachromosomal DNA present in the bacterial cell. These are the extra DNA other…
Q: You are working with a recA- strain of E. coli (cannot produce functional RecA, nor carry out…
A: Conjugation is a process in which the bacteria transfers a plasmid (F plasmids) through the…
Q: You have two E. coli strains, XL10 and K12. XL10 is ampicillin resistant, or AmpR, and can grow on…
A: The plasmid is the extrachromosomal material found in bacterial cells. They contain various…
Q: When E. coli cells are mixed with recombinant vector DNA and subject to a stress such as heat shock,…
A: Prokaryotes are the single celled organisms (unicellular) and are the simplest form, which do not…
Q: elow is a depiction of a replication bubble. 5' AGCTCCGATCGCGTAACTTT 3' TCGAGGCTAGCGCATTGAAA…
A: Without the enzymes, DNA replication is incomplete. The initiation, elongation, termination, and…
Q: Extrachromosomal DNA is critical to the antibiotic resistance found in microorganisms, how do these…
A: Extrachromosomal DNA means a DNA which is present independently of the main DNA or chromosome.…
Q: U have the plasmid pUC18/19, which is a circular plasmid that consists of 2686 bp. What would the…
A: A restriction endonuclease or restriction enzyme is a bacterial enzyme that cuts dsDNA into…
Q: If deoxyribonucleotides that lack the 3’-OH groups are added during the replication process, what do…
A: “Since you have asked multiple question, we will solve the first question for you. If you want any…
Q: AZT (3'-azido-2',3'-dideoxythymidine) is a drug for HIV infection that gets incorporated into…
A: HIV is a retrovirus. Hence inorder for it to multiply inside the host , it first has to synthesize…
Q: + DNA Fragment with Human Gene Recombinant Plasmid Plasmid Vector Bacterial DNA Recombinant Plasmid…
A: Since there are multiple questions in this particular question I will answer the first one for you.…
Q: A plasmid comprised of B-DNA changed its linking number from 550 to 502, resulting in a superhelix…
A: A plasmid is a small extrachromosomal DNA molecule within a cell that can replicate independently of…
Q: If you use the pUC18 vector to clone in the MCS region, predict the following: a) Do bacteria that…
A: pUC18 [plasmid of the University of California], is a bacterial plasmid that was derived from pBR…
Q: If restriction endonucleases are produced by bacteria within a host, why don’t these enzymes chew up…
A: Introduction A restriction enzyme, restriction endonuclease, or restrictase is an enzyme that…
Q: Using the formulae for dsDNA to calculate g/mol: You have a 4110 bp cloning vector Want to ligate a…
A: The average weight of a single DNA bp is 650 daltons. This can also be represented as 650 g/mol (=…
Q: Will you please help me in understanding these? How many fragments will be formed after…
A: "Since you have asked multiple questions, we will solve the first three questions for you. If you…
Q: Table 2. Starter plate conditions. Starter Plate Bacterial Cas9 DNA Repair System SGRNA Donor Plate…
A: Q.
Q: Assume you have successfully cloned a small (200 bp) fragment of DNA into the polylinker region of a…
A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…
Q: a. What is the purpose of molecular cloning?b. What purpose do selectable markers serve in…
A: Plasmids are small, circular extrachromosomal DNA present in a cell. These extrachromosomal…
Q: 1.1kbp 1.5 kbp Hindll Hindll 0.15 kbp amp 0.25 kbp If you were to digest this plasmid with HindllI,…
A: Plasmids are a small, extrachromosomal segment of DNA(deoxyribonucleic acid) and are mostly found in…
Step by step
Solved in 2 steps
- The sequence of the template strand if a nontemplate strand has the sequence 5 ATGGGGCGC3COMPLEMENTARY DNA SEQUENCE OF GACGGCTTAAGATGC#4 BamI --- 5’ CCTAG ↓G 3’ 5’ ACGCCTAGGACGTATTATCCTAGGTAT CCGCCGCCGT CATCA 3’ 3’ TGCGGATCCTGCATAATAGGATCCATAGGCGGCGGCAGTAGT 5’ Restriction enzyme: Recognition sequence: Number of pieces of DNA: Type of cut:
- a. Replicate this sense strand to create a double-stranded DNA helix. Write your answers in CAPS LOCK with NO SPACES between the nucleotides - e.g. ATGCCGAG..... TGAGGATGAAACTCACACCGGGGCGCAGTTTGGCACTTAGATTCTTGTACACGACCTAGTATAACACAGTT complementary strand: b. Using this DNA double helix, express the gene – i.e. determine the resulting polypeptide sequence by using the correct reading frame. Write your answers using the three letter abbreviation for each amino acid. polypeptide sequence: does the sense strand DNA sequence have 5’ and 3’ UTR sequences? 5'UTR = 3'UTR =Multiple Matching. Fill in the blanks with all the letters of thewords below that apply.________ site of protein synthesis________ carries the codon________ carries the anticodon________ a process synonymous with mRNA synthesis________ bacteriophages participate in this transfer________ duplication of the DNA molecule________ process in which transcribed DNA code is decipheredinto a polypeptide________ involves plasmidsa. replicationb. tRNAc. conjugationd. ribosomee. transductionf. mRNAg. transcriptionh. transformationi. translationj. none of theseWhen DNA is replicated, two new DNA double helices areformed, each consisting of one parental strand and onenew, daughter strand. For this reason, DNA replication iscalled________ .
- somatic cells and CRISPR Cas9#1 HindII --- 5’ GTC ↓ GAC 3’ 5’ ACGACGTAGTCGACTTATTAT GTCGACCCGCCGCGTGTCGACCATCA 3’ 3’ TGCTGCATCAGCTGAATAATACAGCTGGGCGGCGCACAGCTGGTAGT 5’ Restriction enzyme: Recognition sequence: Number of pieces of DNA: Type of cut:The region of DNA, shown below, is being copied. Diagram what happens when the second GT repeat (newly synthesizing strand) slips out (loops out). Diagram what occurs in this and the next round of DNA replication. Describe the change in the DNA sequence that occurs due to this replication slippage. 5’TGCCAGTGTGT3’ACGGTCACACACACATGGAG5’
- DNA polymerase functions from 5’ to 3’ direction. Explain this sentence. Youmay use a figure to aid your explanation.Please answer both question.its all a one question.otherwise I will give downvote. Below is a double strand DNA sequence contain a gene and it will go under transcription, suppose that the 3/ → 5/ is the template strand: 3/-TAC-GAC-CGT-TGG-CTT-CTG-TGT-AGG-TAT-ACC-GAT-ACT-5/ 5-/ATG-CTG- GCA-ACC-GAA-GAC-ACA-TCC-ATA-TGG-CTA-TGA-3/ 1- Write down the mRNA transcript with direction of ends of the strand? 2- Construct the resulted polypeptide chain from translation of the mRNA above based on the following codons translation below AUG: Methionine GCA: Alanine ACC: Threonine UGA: write its name GAA: Glutamic acid GAC: Aspartic acid CUG: Leucine ACA: Threonine UCC: Serine AUA: Isoleucine UGG: Tryptophan CUA: Leucine⦁ Original: ATTTGAGCCMutated: ATTGAGCC. This is an example of what kind of mutation?