Three common ways to repair changes in DNA structure are nucleotideexcision repair, mismatch repair, and homologous recombination repair. Which of these three mechanisms would be used to fix the following types of DNA changes?A. A change in the structure of a base caused by a mutagen in anondividing eukaryotic cellB. A change in DNA sequence caused by a mistake made by DNApolymeraseC. A thymine dimer in the DNA of an actively dividing bacterial cell

Three common ways to repair changes in DNA structure are nucleotideexcision repair, mismatch repair, and homologous recombination repair. Which of these three mechanisms would be used to fix the following types of DNA changes?A. A change in the structure of a base caused by a mutagen in anondividing eukaryotic cellB. A change in DNA sequence caused by a mistake made by DNApolymeraseC. A thymine dimer in the DNA of an actively dividing bacterial cell

Biology Today and Tomorrow without Physiology (MindTap Course List)

5th Edition

ISBN:9781305117396

Author:Cecie Starr, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Christine Evers, Lisa Starr

Chapter10: Biotechnology

Section: Chapter Questions

Problem 1CT

See similar textbooks

Similar questions

DNA repair processes use the old DNA strand as the template to repair mismatched bases on the newly synthesized strand . A yeast strain (yst150) has a mutation on the gene coding for the enzyme responsible for distinguishing between the old and new strand of DNA . How does the mutation rate of strain yst150 compare with the rate of non-mutant (wild-type ) yeast ? Explain your answer .
Below is a sample of a segment of DNA…(copy from left to right) 3’ TACAATGGGCGACGCGCTTCGTTTCAGATT 5’ 5’ ATGTTACCCGCTGCGCGAAGCAAAGTCTAA 3’ 1.Assume the 6th amino acid is changed from T to G on the DNA template strand. What type of mutation is this? What effect would this have on the protein? Look up an example for this type of mutation. 2, Assume the 5th and 6th amino acids are removed from the DNA template strand. What type of mutation is this? How would this affect the protein? Look up an example of this type of mutation. 3.Which mutation changes the protein more...a point mutation or a frameshift mutation. Explain your reasoning. 4.What would be the problem if ATT was inserted into the DNA template strand after the second codon? (Be sure to consult the coding chart for amino acids). 5. What if the second amino acid was repeated over 5Ox. What amino acid is repeated? What type of mutation is this? If this is on chromosome 4, what genetic disorder is this?…
Aflatoxin B1 is a highly mutagenic and carcinogenic compound produced by certain fungi that infect crops such as peanuts. Aflatoxin is a large, bulky molecule that chemically bonds to the base guanine (G) to form the aflatoxin-guanine adduct that is pictured below. In the figure below, the aflatoxin is orange, and the guanine base is purple. This adduct distorts the DNA double helix and blocks replication. a. What type(s) of DNA repair system is (are) most likely to be involved in repairing the damage caused by exposure of DNA to aflatoxin B1? b, Recent evidence suggests that the adduct of guanine and aflatoxin B1 can attack the bond that connects it to deoxyribose; this liberates the adducted base, forming an apurinic site. How does this new information change your answer to part (a)?
Consider the ends of the DNA fragments shown below. They have been produced by digestion of a single sequence of DNA using a number of restriction endonucleases. 1. 5'A 3' 3'TTCGA5' 2. 5'G 3' 3'CAGCT5' 3. 5'AATTC3' 3' G5 4. 5'TCGAC3' 3' G5' 5. 5'GGG 3' 3'CCC 5' Which of these ends are capable of annealing and being joined by DNA ligase?
Is each of the following mutations a transition, transversion, addition,or deletion? The original DNA strand is 5′–GGACTAGATAC–3′(Note: Only the coding DNA strand is shown.)A. 5′–GAACTAGATAC–3′B. 5′–GGACTAGAGAC–3′C. 5′–GGACTAGTAC–3′D. 5′–GGAGTAGATAC–3′
What will most likely be the effect of the change in the DNA molecule? * A. the change will cause a harmful mutation B. the DNA molecule will be unable to replicate C. the organism will be reproduce D. the DNA molecules will code for a different protein Original strand: T A C G T A T G A A G C, Mutant strand: T A G C T A T G A A G C. what type of mutation? * A. Substitution B. Deletion C. Insertion D. Nonsense Which mechanism contributes to accuracy during DNA Replication? * A. The mismatch repair system recognizes an incorrect base-pair and corrects the mistake in the non-methylated strand B. Using primers increase accuracy because the first nucleotides is a new nucleic acid chain are more like to be correct. C. all DNA polymerase have a 5'-3' exonuclease activity which can remove…
Which of the following types of DNA damage would be hardest to repair using the DNA repair pathways?A. Complete removal of three nucleotides in the middle of one strand.B. A covalent bond between a base on one strand and a base on the complementary strand.C. Incorporation of a sugar other than deoxyribose into one strand.D. Covalent attachment of a short polypeptide to a single base.E. A covalent bond between a base and a deoxyribose on the same strand. Please explain why it's B
A single DNA molecule contains two specific target sites separated by an intervening sequence. If site-specific recombination between these sites causes the intervening sequence to be released as a separate circular DNA molecule containing one target site, then the sites were oriented in A) opposite directions causing excision. B) the same direction causing excision. C) opposite directions causing integration. D) the same direction causing integration. E) the same direction causing inversion.
The figure below shows the fomation of a bulky-DNA adduct with benzopyrene which is a toxicant commonly found in cigarette smoke. If this adduct were present in a actively transcribed gene in a eukaryote, which genes below would be required to repair this bulky-adduct (select all that apply)? A. RNA Polymerase II B. DNA Poymerasel delta C. XPC D. DNA Polymerase Beta E. XPD Helicase
In some organisms, UV-induced thymine dimers can be repaired by photoreactivation, in which energy from visible light is used to split the bonds forming the cyclobutane ring ? true or false Non-homologous end joining occurs when enzymes cut out a few nucleotides around a double strand DNA break, and then fuse the ends back together (right) true or false?
Which DNA repair systems you think might be capable of repairing a situation where T is in one strand and G is in the complementary strand? Explain dramatically.
How does E. coli determine which nucleotide to "fix" in a base mismatch? The appropriate DNA repair system: A.recognizes fully methylated DNA and replaces the purine. B. recognizes partially methylated DNA and replaces the pyrimdine. C. Recognizes partially methylated DNA and fixes the methylated strand D. Recongnizes partially methylated DNA and fixes the nonmethylated strand E. Makes no distiction between strands, and therefore fixes the wrong base 50% of the time