DNA Fragmentwich Human GeneRecombinantPlasmidPlasmid VectorBacterialDNARecombinantPlasmidTransformedBacterial CellBacterial Cell ProducesHuman ProteinGenes for medically important proteins can be cloned and inserted into bacteria resulting in recombinant bacterial DNA, as shown in the diagram below.Why can bacteria recognize a human gene and then produce a human protein?Bacterial cells and human cells contain the same kind of chromosomesBacterial cells contain the same organelles as human cellsO DNA replication in bacteria and humans is the sameO The basic components of DNA are the same in humans and bacteria A forest food web is shown in the figure. Which organism listed in the answer choices is a herbivore and primary consumer in this food chain?treeskunkpanthermouse

Name: DNA Fragmentwich Human GeneRecombinantPlasmidPlasmid VectorBacterialD
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: DNA Fragmentwich Human GeneRecombinantPlasmidPlasmid VectorBacterialDNARecombinantPlasmidTransformedBacterial CellBacterial Cell ProducesHuman ProteinGenes for medically important proteins can be cloned and inserted into bacteria resulting in recomb

Since there are multiple questions in this particular question I will answer the first one for you.…

Science

Biology

+ DNA Fragment with Human Gene Recombinant Plasmid Plasmid Vector Bacterial DNA Recombinant Plasmid Transformed Bacterial Cell Bacterial Cell Produces Human Protein Genes for medically important proteins can be cloned and inserted into bacteria resulting in recombinant bacterial DNA, as shown in the diagram below Why can bacteria recognize a human gene and then produce a human protein? O Bacterial cells and human cells contain the same kind of chromosomes Bacterial cells contain the same organelles as human cells O DNA replication in bacteria and humans is the same The basic components of DNA are the same in humans and bacteria 이

+ DNA Fragment with Human Gene Recombinant Plasmid Plasmid Vector Bacterial DNA Recombinant Plasmid Transformed Bacterial Cell Bacterial Cell Produces Human Protein Genes for medically important proteins can be cloned and inserted into bacteria resulting in recombinant bacterial DNA, as shown in the diagram below Why can bacteria recognize a human gene and then produce a human protein? O Bacterial cells and human cells contain the same kind of chromosomes Bacterial cells contain the same organelles as human cells O DNA replication in bacteria and humans is the same The basic components of DNA are the same in humans and bacteria 이

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter30: Protein Synthesis

Section: Chapter Questions

Problem 1P

See similar textbooks

Similar questions

U have the plasmid pUC18/19, which is a circular plasmid that consists of 2686 bp. What would the number of and length of the fragments be if you cut the plasmid with the following restriction enzymes or combination of enzymes? Give a schematic representation of the digestions. PscI & GsuI ______________________________________________________________ ScaI, PdmI & BsaXI ______________________________________________________________ ScaI, SspI & EheI ______________________________________________________________
The human RefSeq of the entire first exon of a geneinvolved in Brugada syndrome (a cardiac disordercharacterized by an abnormal electrocardiogram andan increased risk of sudden heart failure) is:5′ CAACGCTTAGGATGTGCGGAGCCT 3′The genomic DNA of four people (1–4), three ofwhom have the disorder, was subjected to singlemolecule sequencing. The following sequences represent all those obtained from each person. Nucleotidesdifferent from the RefSeq are underlined. Individual 1:5′ CAACGCTTAGGATGTGCGGAGCCT 3′and5′ CAACGCTTAGGATGTGCGGAGACT 3′Individual 2:5′ CAACGCTTAGGATGTGAGGAGCCT 3′Individual 3:5′ CAACGCTTAGGATGTGCGGAGCCT 3′and5′ CAACGCTTAGGATGGCGGAGCCT 3′Individual 4:5′ CAACGCTTAGGATGTGCGGAGCCT 3′and5′ CAACGCTTAGGATGTGTGGAGCCT 3′a. The first exon of the RefSeq copy of this gene includes the start codon. Write as much of the aminoacid sequence of the encoded protein as possible,indicating the N-to-C polarity.b. Are any of these individuals homozygotes? If so,which person and what allele?c. Is…
Do virtual restriction digests of 300ng pGLO plasmid using HinDIII, EcoRI, and XhoI separately, and a double digest of pGLO with HinDIII plus EcoRI. How many nanograms of DNA should we expect to be contained within the slowest bandfrom the HinDIII-digest of pGLO?
BamHI cut sequence: G//GATCC and each sequence is 250 nucleotides long. How many DNA segments would be created by cutting the normal gene with BamHI?
2AQ:You are cloning the genome of a new DNA virus into pUC18.You plate out your transformants on ampicillin plates containing X-gal and pick one bluecolony and one white colony. When you check the size of the inserts in each plasmid (blueand white), you are surprised to find that the plasmid from the blue colony contains a verysmall insert of approximately 60 bp, while the plasmid from the white colony does notappear to contain any insert at all. Explain these results.
The technique of fluorescence in situ hybridization (FISH) is described. This is another method for examining sequence complexity within a genome. In this method, a DNA sequence, such as a particular gene sequence, can be detected within an intact chromosome by using a DNA probe that is complementary to the sequence.For example, let’s consider the β-globin gene, which isfound on human chromosome 11. A probe complementary to theβ-globin gene binds to that gene and shows up as a brightly colored spot on human chromosome 11. In this way, researchers can detectwhere the β-globin gene is located within a set of chromosomes. Becausethe β-globin gene is unique and because human cells are diploid(i.e., have two copies of each chromosome), a FISH experimentshows two bright spots per cell; the probe binds to each copy ofchromosome 11. What would you expect to see if you used thefollowing types of probes?A. A probe complementary to the Alu sequenceB. A probe complementary to a tandem array near…
Eukaryotic genomes are replete with repetitive sequences that make genome assembly from sequencereads difficult. For example, sequences such asCTCTCTCTCT . . . (tandem repeats of the dinucleotide sequence CT) are found at many chromosomallocations, with variable numbers (n) of the CT repeating unit at each location. Scientists can assemblegenomes despite these difficulties by using the pairedend sequencing strategy diagrammed in Fig. 9.9. Inother words, they can make libraries with genomicinserts of defined size, and then sequence both endsof individual clones. Following are 12 DNA sequence reads from sixcloned fragments analyzed in a genome project. 1Aand 1B represent the two end reads from clone 1, 2Aand 2B the two end reads from clone 2, etc. Clones1–4 were obtained from a library in which the genomic inserts are about 2 kb long, while the inserts inclones 5 and 6 are about 4 kb long. All of these sequences have their 5′ ends at the left and their 3′ endsat the right. To simplify…
3a)ClustalX software was used to perform multiple sequence alignment of thefollowing five Nco protein sequences designated as Nco1-Nco5 (the provided figure). A pair of degenerate primers was designed to PCR-amplify a DNA segment with the size of approximately 290 bp. With justification, discuss which amino acidsequence blocks would be suitable to design the forward and reverse degenerate primers.
. The double-stranded circular DNA molecule thatforms the genome of the SV40 tumor virus can be denatured into single-stranded DNA molecules. Becausethe base composition of the two strands differs, thestrands can be separated on the basis of their densityinto two strands designated W(atson) and C(rick). When each of the purified preparations of the single strands was mixed with mRNA from cells infectedwith the virus, hybrids were formed between the RNAand DNA. Closer analysis of these hybridizationsshowed that RNAs that hybridized with the W preparation were different from RNAs that hybridized withthe C preparation. What does this tell you about thetranscription templates for the different classes ofRNAs?
The sequence at one end of one strand of the Drosophilatransposon Mariner is shown below (dots indicatesequences within the transposon):5′ TTAGTTTGGCAAATATCTCCCTTCCGCCTTTTTGATCTTATGT... 3′You obtain a mutant bacterial strain tagged with anengineered Mariner transposon, cut the genomicDNA from this strain with the restriction enzymeMboI (whose recognition site is ^GATC), and circularize the resultant DNA fragments by diluting therestriction enzyme digest and adding DNA ligase.a. Design two 17 bp PCR primers that you could useto identify (by inverse PCR) the gene into whichthe transposon inserted.b. What DNA sequence will be amplified from thecircularized fragments of the mutant genome?Show the extent of this DNA sequence on a mapof the genome of the mutant strain, indicating thelocations of the transposon insertion and any relevant sites for the enzyme MboI.
In a genome project, the following genomic DNA sequences were obtained. Assemble the sequences into a contig. Using the assembled sequence, perform a BLASTn search. Does the search produce sequences similar to your assembled sequence? 5’ TCGGGGTCCTGGGATCTCATCACTGCAGCGC 3’ 5’ACTGCAGCGCTTTCCCAGCGGGCGGTGGTAC 3’ 5’GGGCGGTGGTACTCGGGAAGTCAGGAGTGTT 3’ 5’AGGAGTGTTTAAAACCTGGGGACTGGTTTTG 3’ 5’TGGTTTTGGGGGCGCTGAAGGCAGCGCAGGA 3’
You know from your calculationsthat only a small proportion of the human genome is represented, even when the entire class results areconsidered. Therefore, the chance of finding a particular single-copy gene in your library is very small.Outline a strategy for constructing a genomic DNA library more representative of the entire humangenome. You will need to consider alternative vectors and the efficiency of transformation of thebacterial cells.