The following is a block diagram where the building blocks are labeled with letters and the linkages between building blocks are labeled with numbers. A 1 2 B C a. Which building blocks are fatty acid residues? b. Which building blocks are carbohydrate residues? C. Which linkages are amide linkages? 1. Which linkages could involve a monosaccharide?

Q: Select the chemical consequences that could contribute to DNA instability at AP sites. fewer…

A: AP sites are apuraniya sites that are created through the hydrolysis of N glycosyl bond between…

Q: Suggest a curve illustrating the logD of amphetamine as a function of pH (from pH 1 - 14).

A: LogD is a distribution constant used to define the lipophilicity of a drug. LogD gives more accurate…

Q: Why do some starch products set as they cool?

A: Introduction Starch is a carbohydrate which is commonly found in nature like wheat, rice, potatoes…

Q: What is binding energy? What do negative and less negative energies represent? How does this relate…

A: Binding energy is the amount of energy required to separate a system into its constituents. If we…

Q: Consider the structure of the tripeptide (in its fully protonated form) below. H O H I | || + O=C…

A: The amino acids contain ionizable groups. The ionizable groups are of the following types: the amino…

Q: QUESTION 5 Oxaloacetate Acetyl-CoA AG" = -7.7 kcal/mol COA Citrate Fatty acids AG"=-1.5 kcal/mol…

A: Free energy change (∆G) of a reaction helps to find the spontaneity of a reaction. Negative ∆G of a…

Q: Calculate the resulting equilibrium concentrations of all four species. Express your answers to four…

A: In a general reaction such as: aA + bB ⇌ cC + dD At equilibrium, the concentration of reactants and…

Q: 1. I Draw the amino acids Asn and His and show the most prevalent interaction that would occur…

A: Amino acids are biomolecules with an amino group, a carboxyl group and a side group linked to the…

Q: A reaction has a Gibbs free energy change (AG) of +5.3 kcal/mol. Indicate whether each of the…

A: Introduction   The Gibbs free energy of a system means the amount of usable energy. The change in…

Q: 3. In the experiment shown below, researchers looked at the effects of glucose-free medium on…

A: Glutamate is an amino acid that is synthesized from glutamine and through the transamination of…

Q: DNA: How PCR works and why it's useful?

A: PCR is dependent on the ability of DNA polymerase to generate a new strand of DNA that is…

Q: A student is trying to add 15.0 ng of DNA template to a 20.0 µL PCR.  The DNA template is at a…

A: Polymerase Chain Reaction or PCR is a method to make multiple copies of DNA starting from a small…

Q: Compare the principle behind DNA migration in an agarose gel electrophoresis from that of protein…

A: Electrophoresis means the migration of a charged particle under the influence of an applied electric…

Q: Give the corresponding class, subclass, sub-subclass, specific enzyme of the following E.C. codes.…

A: Enzymes are proteins which serve as catalyst for a biochemical reactions. It doesn’t get involved in…

Q: d) Alcohols usually don't behave as a weak acids, but tyrosine does. Explain why Y ionizes, while S…

A: Note: Hi! Thank you for the question. We are authorized to answer one question at a time. Since you…

Q: Insulin deficiency (occurrence/factors) factors affecting insulin levels including biological,…

A: The hormone insulin is in charge of permitting blood glucose to enter cells, giving them the energy…

Q: A mixture of five proteins are analyzed by MALDI-TOF. Their molecular weigths are 3 kD, 22 kD, 100…

A: Mass spectrometry is an analytical method that involves ionizing materials into charged molecules so…

Q: 2. The two diagrams to the right il- lustrate plots of steady-state ki- netic studies to…

A: Phosphofructokinase-1 (PFK-1) is a rate limiting enzyme of the glycolytic pathway. PFK-1 catalyzes…

Q: Inhibitors for this reverse transcriptase fall in two classes: nucleoside analog inhibitors (NRTIs)…

A: Reverse transcriptase is an enzyme that synthesizes DNA from RNA. Reverse transcriptase catalyzes…

Q: What will be the result for each qualitative test if the intact casein contains the following…

A: Proteins are folded peptides. Peptides are made up of amino acid residues linked via a peptide bond.…

Q: At a substrate concentration that is much greater than the Km for the reaction, which statement is…

A: An increase in the substrate concentration increases the reaction velocity. The reaction reaches…

Q: Acetyl-CoA is generated by E1 and E2 ... purpose of E3? (PDHC)

A: INTRODUCTION : Acetyl-CoA - It is a enzyme which is involved in many biochemical reactions of…

Q: 1. What is the possible identity of the amino acid? [ Select] V 2. What is the isoelectric point of…

A: Amino acids are biomolecules that have an amino group, a carboxyl group and a side group that is…

Q: Riboflavin is an important nutrient required for a number of biochemical processes that produce…

A: Riboflavin is commonly known as vitamin B2. Riboflavin is a type of Vitamin B. It is soluble in…

Q: Consider the pyruvate carboxylase reaction, the first bypass step in gluconeogenesis: Pyruvate + CO₂…

A: Gluconeogenesis is a process by which cells make glucose from non carbohydrate sources.…

Q: Write the schematic diagram of lodine Value Determination as shown in the video by Amrita Vlab:

A: Simple fats are triglycerides. Triglycerides or triacylglycerols are fatty acid esters of glycerol.…

Q: Cyt cb562 will form a tetramer in the presence of Zn+2 or in the absence of Zn+2, it will form a…

A: INTRODUCTION : Cyt cb562 - Cytochrome cb562 is a variant of an Escherichia coli four-helix bundle…

Q: 6-25 For Umax 57(Kr+S) constant an enzyme that displays Michaelis-Menten kinetics, what is the…

A: For a one-substrate enzyme-catalyzed reaction, the Michaelis-Menton equation shows the quantitative…

Q: Amino acid analysis of a HEPTAPEPTIDE reveals the following information below: (NOTE: when the…

A: The proteins are composed of sequence of amino acids connected via peptide bonds. The sequence of…

Q: Whether done manually or automated, DNA sequencing gels are always made of polyacrylamide rather…

A: Sequencing DNA entails finding the order of the four chemical building components known as "bases"…

Q: Below is a fractional saturation curve for O2 binding to adult hemoglobin. Assume that curve Y…

A: Fractional saturation curve of Haemoglobin for oxygen binding describes the amount of oxygen that is…

Q: Which amino acid pair constitutes the hydrophobic patch on sickle cell hemoglobin that results in…

A: Sickle cell disease is caused due to inversion of one base pair (A -> T). Due to which, the sixth…

Q: why is having a more reductive environment will alter the functional characteristics of alpha…

A: Keratin is a protein that is of two types: alpha and beta keratin. Alpha keratin is alpha helix…

Q: 5. In the early days of protein biochemistry, these proteins were described using "operational…

A: Operational definition is applicable to many things in our everyday life. It is most popularly used…

Q: H ОН CH2OH D H ОН H 0 البلاد - ОН H CH2OH H H ОН H 0 ОН Which of the following statements correctly…

A: The sugars often contain alcohol and carbonyl functional groups and the intramolecular hemiacetal…

Q: Show how the addition of a competitive inhibitor would affect the reaction velocity and…

A: Enzymes are high molecular weight proteins that catalyse biochemical reactions. They contain an…

Q: Thick filaments are part of the I band contain actin O contain myosin but thin filaments do/are not.…

A: In each microfibril, actin thin filaments and myosin thick filaments are organized into a linear…

Q: INFLUENCE OF FREE ACID tt #1 tt #2 tt #3 tt #4 CONDITION 4 mL 0.2% HCI + 1 mL starch paste + 1 drop…

A: Effect of saliva on starch: Saliva contains the digesting enzyme amylase, which breaks down starch.…

Q: 3. DNA: TACGGGCCTATACGCTACTAC TCATGGATCGG mRNA: Codon: Anitcodon: Amino Acids:

A: The flow of genetic information from DNA to RNA, RNA to protein synthesis is called central dogma.…

Q: How many reduced molecules (NADH, FADH2, NADPH) will be generated by converting linoleic acid…

A: Fatty acids are carboxylic acids with a hydrocarbon chain ranging from 4 carbon to 36 carbons.…

Q: Questions Not yet answered Flag question Question 5 Not yet Flag question Complete the following…

A: Note: We are authorized to answer one question at a time. Since you have not mentioned which…

Q: Give a CHEMICAL test that can differentiate the pair of sugars and give the results for both. No…

A: Introduction: Carbohydrate is an important source of energy that is important for all living…

Q: Enzyme X exhibits maximum activity at pH = 6.3. X shows a fairly sharp decrease in its activity when…

A: Enzymes are high molecular-weight protein molecules that catalyse biochemical reactions. The…

Q: Which one of the following amino acids is phosphorylated during the process of promoter clearance by…

A: The transcription of genes leading to the synthesis of proteins inside the cells is carried out by…

Q: What is the property/characteristics of DNA that makes it insoluble to ethanol/isopropyl alcohol?

A: The mechanical separation of the nuclear contents from the remainder of the cell, accomplished by…

Q: Fast please At 20 Celsius degree, protein-Z binds DNA with a free energy of –7 kJ/mole. Protein Z…

A: Free energy: Whether reactants and products will change spontaneously depends on the amount of free…

Q: Can you write possible mineralization and biotransformation reactions for glucose (C6H12O6) ?

A: Biotransformation is the biochemical process (metabolism) taking place in some life form that alters…

Q: 0 I ОН CH2-CH-CH-CH-C-H ОН ОН ОН ОН

A: Chiral carbon is the carbon atom attached to four different substituents. If any carbon atom is…

Q: what are the molecular descriptors of phosphatidylinositol?

A: Phosphoinositides are the phospholipids comprising a water soluble head group i.e. myoinositol…

Q: Glutamine is an amino acid that has -CH₂-CH₂-CO-NH₂ as its R group. The R group of the amino acid…

A: There are hundreds of different amino acids however only 20 different amino acids participate in…