The following is the DNA sequence of the entire protein-coding region for some small gene in a eukaryote. Shown is the coding strand. The first row is the original sequence with no mutations. Subsequent rows represent a single mutation. Mutation DNA Sequence ..ATGGGCGAGGTA TTATA G.. 3' None 5' A ..A TGGGCGAGATATTATA G.. 3' 5' B ..A TG G GCGAGGTA CTATA G.. 3' 5' 5' ..A TGG C CGAGGTAT TATA G.. 3' The region without a mutation is transcribed, and then translated. Give the protein that is translated from this section of DNA. Use the single letter abbriviations for amino acids with no spaces. N- Determine the molecular basis for each mutation and what effect there would be on the protein. Mutation Molecular Basis Effect on Protein A Transition B Transition C Transversion Nonsense Synonymous Nonsynonymous

The following is the DNA sequence of the entire protein-coding region for some small gene in a eukaryote. Shown is the coding strand. The first row is the original sequence with no mutations. Subsequent rows represent a single mutation. Mutation DNA Sequence ..ATGGGCGAGGTA TTATA G.. 3' None 5' A ..A TGGGCGAGATATTATA G.. 3' 5' B ..A TG G GCGAGGTA CTATA G.. 3' 5' 5' ..A TGG C CGAGGTAT TATA G.. 3' The region without a mutation is transcribed, and then translated. Give the protein that is translated from this section of DNA. Use the single letter abbriviations for amino acids with no spaces. N- Determine the molecular basis for each mutation and what effect there would be on the protein. Mutation Molecular Basis Effect on Protein A Transition B Transition C Transversion Nonsense Synonymous Nonsynonymous

Name: The following is the DNA sequence of the entire protein-coding region
Uploaded: 2024-03-20T06:42:55.000Z
Channel: Bartleby
Description: The following is the DNA sequence of the entire protein-coding region for some small gene in a eukaryote. Shown is the coding strand. The first row is the original sequencewith no mutations. Subsequent rows represent a single mutation.MutationDNA Se

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter11: Genome Alterations: Mutation And Epigenetics

Section: Chapter Questions

Problem 10QP: If the coding region of a gene (the exons) contains 2,100 base pairs of DNA, would a missense...

See similar textbooks

Similar questions

A small section of a gene for a protein has the following nucleotide sequence: GCT CTA GCT ATC TGA Which of the following mutations would cuase a silent mutation in the sequence shown above? a. Replacement of second adenine base with thymine base b. Replacement of first thymine base with adenine base c. Replacement of second guanine base with cytosine base d. Replacement of first cytosine base with guanine base
A molecular geneticist hopes to find a gene gene in human liver cells that codes for an important blood clotting protein. He knows that the nucleotides sequence of a small part of the gene is GTGGACTGACA. briefly explain how to obtain the desired gene
A molecular geneticist hopes to find a gene in human liver cells that codes for an important blood-clotting protein. He knows that the nucleotide sequence of a small part of the gene is GTGGAСTGACA. Briefly explain how to obtain the desired gene.
a molecular geneticist hopes to find a gene in human liver cells that codes for an important blood-clotting protein. he knows that the nucleotide sequence of a small part of the gene is gtggactgaca. briefly explain how to obtain the desired gene answer
A molecular geneticist hopes to find a gene in human liver cells that codes for an important blood-clotting. He knows that the nucleotide sequence of a small part of the gene is GTGGACTGACA. Briefly explain how to obtain the desired gene.
A molecular geneticist hopes to find a Gene in human liver cell that codes for an important blood-clotting protein,he knows that the nucleotide sequence of a small part of the Gene is GTGGACTGACA.briefly explain how to obtain gene
(a.) When a mutation occurs to the given sequence of DNA, it will be; 5' CTATAAGGCGCAAATTCCTGCCAT 3' Then the mRNA sequence will be, 5' GAUAUUCCGCGUUUAAGGACGGUA 3' Amino acids - (Asp Leu Pro Arg Leu Arg Thr Val) (b.) When a mutation occurs to the given sequence of DNA, it will be; 5' CTATAAGGCGGAAATCCCTGCCAT 3' Then the mRNA sequence will be, 5' GAUAUUCCGCCUUUAGGGACGGUA 3' Amino acids - (Asp Leu Pro Pro Leu Gly Thr Val) (c.) When a mutation occurs to the given sequence of DNA, it will be; 5' CTATAAGGCTCAAATCCCTGCCAT 3' Then the mRNA sequence will be, 5' GAUAUUCCGAGUUUAGGGACGGUA 3' Amino acids - (Asp Leu Pro Ser Leu Gly Thr Val) (d.) When a mutation occurs to the given sequence of DNA, it will be; 5' CTATAAGGCGCAAATCCCTCCAT 3¹ Then the mRNA sequence will be, 5' GAUAUUCCGCGUUUAGGGAGGUA 3' Amino acids - (Asp Leu Pro Arg Leu Gly Arg).As the last sequence contains only 2 bases it will not represent any amino acid. question: Choose the types of mutations caused by the changes in parts…
Which of the following would probably cause the most severe damage to a gene's expression and phenotype a. A missense mutation changing the first methionine codon to an arginine codon. b. A deletion of a base in the 455th codon of a 456-amino acid protein. c. Alteration of a UGG codon to a UGA codon at position 324 of a 324 amino acid protein. d. Mutation of a GUC codon (valine) to a GUU codon (valine).
Which of the following describes the effect of a frameshift mutations? * A. all mRNA codons change B. some, but not all , mRNA codons change C. there is no change in mRNA codons D. no correct response Consider the following DNA base sequence 3' TTA ATA 5'. what dipeptide is formed if a DNA point mutation converts ATA to ATG? * A. Cys-Phe B. Tyr-Tyr C. Phe-Leu D. Ser-Tyr Consider the following mRNA base sequence 5' ACC CAC 3', what dipeptide is formed if a point mutation converts ACC to ACU? * A. Thr-His B. Thr-Thr C. His- Ile D. Ile- Asp Which of the following statements below is incorrect? * A. the genetic code is overlapping B. the genetic code is universal C. degenerate codon specify the same amino acids…
Given is the 30 nucleotides in the human gene for hemoglobin (the oxygen-carrying protein in the red blood cells): 5’ TAC-CAC-GTG-GAC-TGA-GGA-CTC-CTC-TTC-AGA 3’ a. What is the complementary strand? b.Deduce the mRNA in this coding region. c.What is the amino acid sequence based on this mRNA? d. A very important mutation in human hemoglobin occurs in this DNA sequence, where the T at nucleotide 20 is replace with an A. The mutant hemoglobin is called sickle cell hemoglobin and is associated with severe anemia. What is the amino acid replacement that results in sickle-cell hemoglobin?
Given is the 30 nucleotides in the human gene for hemoglobin (the oxygen-carrying protein in the red blood cells): 5’ TAC-CAC-GTG-GAC-TGA-GGA-CTC-CTC-TTC-AGA 3’a. What is the complementary strand?b. Deduce the mRNA in this coding region.c. What is the amino acid sequence based on this mRNA?d. A very important mutation in human hemoglobin occurs in this DNA sequence, where the T at nucleotide 20 is replace with an A. The mutant hemoglobin is called sickle cell hemoglobin and is associated with severe anemia. What is the amino acid replacement that results in sickle-cell hemoglobin?
A researcher was mutating prokaryotic cells by inserting segments of DNA. In this way, she made the following mutation:Original TTGACAT 15 to 17 bp TATAATMutant TATAAT 15 to 17 bp TTGACATa. What does this sequence represent?b. What do you predict will be the effect of such a mutation? Explain.