Answered: The following protein sequence was…

The following protein sequence was made. N-MET TYR GLN GLN CYS-C a. Using the top most option from the genetic code table write the mRNA sequence for this protein indicating 5' and 3'.

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter9: Gene Expression And Gene Regulation

Section: Chapter Questions

Problem 16QP: Given the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also,...

See similar textbooks

Related questions

Q: 9/26/22, 1:40 11 What is the name of the body cavity that holds the internal organs of highe…

A: Septum It is a wall, dividing a cavity or structure into smaller ones. Coelom Body cavity filled…

Q: BOTANY The placentation type is often retained when the ovary matures into a fruit. Is it possible…

A: The arrangement of placenta called as placentation. The function of placentation is to transfer…

Q: Initiation. Promotion Progression/ Angiogenesis, tumor migtation Cells multiply uncontrollably DNA…

A: Cancer is defined as rapid non-controllable cell division triggered by either external (UV or…

Q: About _____% of the variance between physical activity levels in humans is due to genetic variation.…

A: Taking care of fitness immediately allows us to be productive and provides us stamina and…

Q: what is bone marrow as an hematopoietic organ

A: Mesenchymal and hematopoietic stem cells are found in bone marrow. Red bone marrow is a fragile,…

Q: Which of these processes are catalyzed by ribozymes? (Select all that apply.) DNA synthesis…

A: A ribozyme is defined as a ribonucleic acid enzyme that is required to catalyse a chemical reaction.…

Q: Describe the fluid compartments (ICF, ECF, blood and interstitial fluid) Describe the distribution…

Q: How is potassium important to the sodium pump a) attracts sodium out of the protein pump surface. b)…

A: Introduction Potassium pump:- This pump is found in cell membrane. ATP is needed for this pump to…

Q: Classify lipid with examples ..

A: Lipids are a heterogeneous class of organic compounds that are fatty acids or there derivatives and…

Q: Answer the following questions: 1. What is the importance of capsule to a microoganism? 2. Why is…

A: Capsules are the outmost structures of bacterial and fungal cells.

Q: The incoming vesicle is responsible for O a) bringing substances into the cell b) synthesizing…

A: Vesicles are small cell organelles that are present in cells. These organelles are small,…

Q: -Which drawing of the intertidal region correctly represents Chthamalus' fundamental niche with an…

A: Every species finds their own niche according to their feeding habits, living conditions, favourable…

Q: . Explain the cell theory

A: In 1665, Robert Hooke became the first scientist to identify the cell. Hooke observed a swarm of…

Q: What evidences supported spontaneous generation? How was spontaneous generation disproved?

A: Introduction The scientific idea of spontaneous generation, which has since been disproved, claimed…

Q: O Biological O Phenetic O Phylogenetic O Parasympathetic 200 A-beaver Dam, AZ B-Twentynine Palms, CA…

A: Introduction Classification means the arrangement of various species into a groups. In the world…

Q: Upper Intertidal Zone Lower Intertidal Zone Balonus kalenvides Chthamalus scellatus The diagram…

A: Introduction: Connell is an American ecologist, but because his research on how interspecific…

Q: After lipids are digested and enter absorptive cells, identify which lipids enter capillaries…

A: Biomolecules called lipids can only dissolve in nonpolar liquids. The term "non-polar solvent"…

Q: + 머 B D C F E -40-4040 | 1602 ㅁㅅㅁ 거머가 40000 I ㅁㅁㅁ ㅅㅁㅅㅁㅅㅁ

A: Introduction: Autoimmunity is a situation in which the attack on one's own antigen by…

Q: Is there any form of matter or energy that could never be considered pollution? Briefly compare and…

A: Our modern lifestyle renders us more susceptible to many illnesses. With increased pollution and bad…

Q: Identify the type of division exhibited by the following: Binary fission Grasses Hydra Budding…

A: Reproduction The process of producing offspring. Reproduction make sure the life continues on earth.

Q: This type of cell transport happens during secretion of hormones, neurotransmitters and digestive…

A: Introduction: Substances travel through the cell membrane during cell transports.The cells allow the…

Q: Describe the fluid properties of the cell membrane and explain how membrane fluidity is influenced…

A: Introduction: The cell membrane performs a variety of tasks, including ion conductivity, cell…

Q: The _____________ plants died, partially decomposed, and became the fossil fuels? (choose all that…

A: Sphagnum Moss: There are over 380 recognised species of mosses in the genus Sphagnum, which is also…

Q: Calculate ΔGinward. Is energy required for transport to happen? The cell is at 25°C. Membrane…

A: Energy is required in cases where there is active transport of molecules as molecules are…

Q: Molecule X is expected to be a non-competitive inhibitor of an enzyme. If the inhibitor was tested…

A: Vmax of a reaction is the maximum velocity of the enzyme that carries out the reaction that is when…

Q: (N + N) 2N N Match the correct stage to the correct ploidy 1. Sporophyte 2. Gametophyte 3.…

A: Introduction PLOIDY:- It is a total number of chromosome sets in somatic cells of the diploid phase…

Q: How will the color change of the bromothymol blue solution be affected by exercise? Be sure to…

A: Bromthymol Blue is a dye used as an indicator in determining pH. Bromthymol blue is a weak acid. It…

Q: Enzyme activity is an important characteristic of enzymes, and its units are moles (M) or milimoles…

A: 2. When substrate concentration ranged from 0 to 20 mM the enzyme activity surged exponentially from…

Q: This week you learned about the role that macrophages, neutrophils, and cytokines play in the innate…

A: Microbial infections are frequently treated with antibiotics. It is getting harder and harder to…

Q: Which of the following is O They are multi-cellular O They exchange genetic O They are eukaryotic. O…

A: Introduction Microbes are microscopic, single cells that are completely invisible to the human eye.…

Q: How does the ankle joint change in structure and function among salamanders, lizards, mammals

A: The ankle joint is also known as the talocrural joint is a synovial joint located in the lower limb.…

Q: One study predicted that trained subjects would have a resting metabolic rate 100-200 kcal/day…

A: The energy spent when a body performs basic functions which are required to stay alive is basal…

Q: What is the purpose of control tubes in an experiment? a. To use up more tubes and look more…

A: The unknown sample is tested and compared to positive and negative controls to determine the test…

Q: Reason why capsule is very important to microorganism?

A: Capsules are the outmost structures of bacterial and fungal cells. It is a polysaccharide layer that…

Q: Where in the body does most digestion occur? a. mouth b. stomach c. small intestine d. large…

A: Digestion is the complex process of converting the food you eat into nutrients that your body can…

Q: A scuba diver at an evenly lit depth thought the surface of the water was over his head. How did he…

A: The cerebellum, the part of the brain which controls movement, receives data on the position of the…

Q: This type of cell transport happens during secretion of hormones, neurotransmitters and digestive…

A: Introduction Cell transports are the movement of a material through the cell membrane. The chemical…

Q: Redraw and rearrange the branches of the tree below to make the most parsimonious (simplest) tree. A…

Q: Explain cell theory in three sentences.

A: Introduction : A cell is the basic structural and fundamental unit of life. Cells are the building…

Q: AaBBdd x AaBbDd punnet square genotype phenotype

A: Introduction A Punnett square is a pictorial depiction of the genetic variants that could be…

Q: The following is a purine: a. Adenine b. Guanine c. Thymine d. A and B e. All of the Above

A: Purines and pyrimidines are both organic compounds that take part in the synthesis of DNA and RNA.

Q: Many obese patients are part of a family in which all, or the majority, of it's members are obese.…

A: Genes are information/ trait encoding units present in the genome or DNA of organisms. These genes…

Q: How is the DNA unwound at the replication fork? What effect does this have on the DNA upstream of…

A: DNA It is a double stranded helical structure present in almost all eukaryotic cell.

Q: What is the purpose of the following substances in the dna extraction procedure: Detergent…

A: DNA extraction The process of removal of dna molecule from inside the cell.

Q: Use the graphs below to answer the following 5 questions. Biomass Time The growth of Lemna polyrhiza…

A: Intraspecific competition The competition between two same species is know as intraspecific…

Q: Why is there a need to provide the magnification of a specimen drawn

A: Microscopy is used to visualise the objects such as tissues, cells, nanoparticles etc. which can not…

Q: Which of the following occurs when red blood cells are transferred from an isotonic solution to a…

A: Many biological subdisciplines exist within cell biology. An illustration of this would be studying…

Q: The following are the conditions that determines the direction of ions as it pass through the…

A: Introduction : A membrane that permits certain molecules to pass through it but not others is said…

Q: Which of the following statements is NOT TRUE about membrane transport? to facilitate movement of…

A: The cell is the primary and fundamental unit of life and each living organism is made up of a cell…

Q: Translate the mRNA into a protein using the genetic code. (Amino acid chain.) AUG( met)-UUU(…

A: Introduction The genetic code is a set of instructions that enable live cells to produce proteins…

Question

The following protein sequence was made.
N-MET TYR GLN GLN CYS-C
a. Using the top most option from the genetic code table write the mRNA sequence
for this protein indicating 5' and 3'.
b. Now write the template strand indication 5' and 3'

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step 3

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 3 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Given the following mRNA, write the double-stranded DNA segment that served as the template. Indicate both the 5 and the 3 ends of both DNA strands. Also write out the tRNA anticodons and the amino acid sequence of the protein encoded by the mRNA message. DNA: mRNA: 5-CCGCAUGUUCAGUGGGCGUAAACACUGA-3 protein: tRNA:
The following segment of DNA codes for a protein. The uppercase letters represent exons. The lowercase letters represent introns. The lower strand is the template strand. Draw the primary transcript and the mRNA resulting from this DNA.
Figure 28.41 gives some examples of recombination in IgG codons 95 and 96, as specified by the Vkand Jkgenes. List the codon possibilities and the amino acids encoded if recombination occurred in codon 97. Which of these possibilities is less desirable?
Given the following DNA sequence: ATCGGATCCGGTTAACTATTTAAAGCA a. predict the compliment strand of dna (coding strand) b. predict the transcribed product of the coding strand (mRNA transcript) c. given the genetic code table, predict the amino acid sequence of the transcript d. predict the amino acid sequence if the A underlined became deleted
Consider a template strand of DNA with the following sequence: 3 '–CAA TGT ATT TTT GCT–5 '. (a) What is the informational strand of DNA that corresponds to this template? (b) What mRNA is prepared from this template? (c) What polypeptide is prepared from the mRNA?
Given the following DNA sequence from the template strand of a given gene: 5'CTTGCGTCACCTAAGACCTGTCATCG3' a) Write the mRNA that will be transcribed from the DNA sequence above (be sure to label the 5' and 3' ends) b) Write the peptide sequence translated from the mRNA produced in part a.
if the DNA sequence if: TTACGTA, the complementary RNA sequence will be following A. AATCGAT B. AATGCTA C.AATGCAT D.AAUGCAU
Considering the given sequence of nucleotides in an mRNA molecule, (a) what is the sequence of the DNA template strand from which the RNA was synthesized? (b) What peptide is synthesized by this mRNA sequence? 5' GAG CCC GUA UAC GCC ACG 3'
For the following DNA sequence: 3’–CGATACGGCTATGCCGGCATT–5’Write: b) the sequence of the corresponding segment of mRNA formed using the DNA segment above as the template
If the sequence of an mRNA is GAGUUCACAGUAGGC, the sequence of the template strand of the corresponding gene is... which of the following answers? a. CTCAAGTGTCATCCG b. GCCTACTGTGAACTC c. 3' GAGTTCACAGTAGGC 5' d. GAGTTCACAGTAGGC e. none of the above
Codon to be read in the mRNA is 5' GAA 3', what is the amino acid? a. E b. K c.F d.L
A DNA antisense strand contains the following nucleotide base sequence:CGA TTT GGT TGAFrom this, what is the nucleotide sequence of the mRNA strand that is transcribed? a. CGA UUU GGU UGA b. GCU AAA CCA ACU c. GCA AAA CCA ACT d. CGA TTT CCA ACT