The following is the DNA sequence of the entire protein-coding region for some small gene in a eukaryote. Shown is the coding strand. The first row is the original sequence with no mutations. Subsequent rows represent a single mutation. Mutation DNA Sequence None 5'..A TG GAG G T ATTA TA G.. 3' A 5' ..A TG GGCGAGATAT TATA G.. 3' В 5' ..A TGGGCGAG GTA CTATA G.. 3' C 5'..A TGGCCGAGGTATTATA G.. 3' The region without a mutation s transcribed, and then translated. Give the protein that is translated from this section of DNA. Use the single letter abbriviations for amino acids with no spaces. N- -C Determine the molecular basis for each mutation and what effect there would be on the protein. Mutation Molecular Basis Effect on Protein

The following is the DNA sequence of the entire protein-coding region for some small gene in a eukaryote. Shown is the coding strand. The first row is the original sequence with no mutations. Subsequent rows represent a single mutation. Mutation DNA Sequence None 5'..A TG GAG G T ATTA TA G.. 3' A 5' ..A TG GGCGAGATAT TATA G.. 3' В 5' ..A TGGGCGAG GTA CTATA G.. 3' C 5'..A TGGCCGAGGTATTATA G.. 3' The region without a mutation s transcribed, and then translated. Give the protein that is translated from this section of DNA. Use the single letter abbriviations for amino acids with no spaces. N- -C Determine the molecular basis for each mutation and what effect there would be on the protein. Mutation Molecular Basis Effect on Protein

Name: The following is the DNA sequence of the entire protein-coding region
Uploaded: 2024-03-20T06:42:55.000Z
Channel: Bartleby
Description: The following is the DNA sequence of the entire protein-coding region for some small gene in a eukaryote. Shown is thecoding strand. The first row is the original sequence with no mutations. Subsequent rows represent a single mutation.MutationDNA Se

Biology (MindTap Course List)

11th Edition

ISBN:9781337392938

Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Publisher:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Chapter13: Gene Expression

Section: Chapter Questions

Problem 12TYU

See similar textbooks

Similar questions

-Write down the complementary DNA sequence. TACCTAGCG CACATGTAGGTGGGCAAAGTT -Write down the complementary mRNA sequence for each of the following DNA sequence. A: TACCTAGCGCACATGTAGGTGGGCAAAGTT B: TAC ATG GTT ACA GTC TAT TAG ATG CTA TTT ACT TAG -If the first G changes to A what kind of mutation will happen? Show the change in amino acid sequence. This is base substitutions involve the replacement of one nucleotide with another. And it changes one amino acid coding, producing a missense mutation TAC CTA GCA CAC ATGTAGGTGGGCAAAGTT TAC CTA ACACACATGTAGGTGGGCAAAGTT
A small section of bacterial DNA template (antisense) strand has the following nucleotide sequence: CGA AAA GAG AAT A mutation in the above sequence involved a substitution of a single base, resulting in an incomplete protein due to a nonsense mutation. Which of the following gen sequences exemplifies the mutation described above? a. CGA UAA GAG AAT b. CGA AAA AAG AAT c. CGA AAA GAG ACT d. UGA AAA GAG AAT
You have the following DNA coding sequence of a wild-type allele: 5’-ATG TTC CAG CTA GAT GAT ATG CTG GTA ATT GGG GAA CGC GCG CGG TAA-3’ For each of the following mutations: A. State whether the mutation is missense, nonsense, frameshift, or silent. B. Write the codon change that occurs for the missense, nonsense, and silent mutations (ex. GAA -- GAT). C. For frameshift mutations, write out the entire mutant sequence with each codon clearly indicated (if the frameshift creates a new stop codon, end the sequence at the new stop). Using the wild type DNA sequence above as a guide : Write the amino acid sequence of the mutants. Mutant 1: transition at nucleotide 23 Mutant 2: T --> G transversion at nucleotide 29 Mutant 3: an insertion of “A” after nucleotide 14 Mutant 4: transition at nucleotide 7 Mutant 5: An insertion of GG after nucleotide 40 Mutant 6: transition at nucleotide 15 Mutant 7: a deletion of nucleotide 25
A molecular geneticist hopes to find a Gene in human liver cell that codes for an important blood-clotting protein,he knows that the nucleotide sequence of a small part of the Gene is GTGGACTGACA.briefly explain how to obtain gene
A researcher was mutating prokaryotic cells by inserting segments of DNA. In this way, she made the following mutation:Original TTGACAT 15 to 17 bp TATAATMutant TATAAT 15 to 17 bp TTGACATa. What does this sequence represent?b. What do you predict will be the effect of such a mutation? Explain.
A molecular geneticist hopes to find a gene in human liver cells that codes for an important blood-clotting protein. He knows that the nucleotide sequence of a small part of the gene is GTGGAСTGACA. Briefly explain how to obtain the desired gene.
Assume a bacterial gene underwent a mutation, where a thymine base from an early portion of the coding sequence of the DNA is replaced with a cytosine (as illustrated below). Original sequence (coding strand): AGTTCCTACAAAATGGAGCTGTCTTGGCATGTAGTCTTT ...[Sequence continues with another 80 bases] New sequence: AGTTCCCACAAAATGGAGCTGTCTTGGCATGTAGTCTTT...[Sequence continues with another 80 bases] UAC encodes tyrosine, CAC encodes histine, per the coding table. (This question can be answered without use of the code table, but it is provided here as a resource.) What would the expected result of such a mutation be on the final protein product of the mutated gene (compared to the original, non-mutant product)? The protein will be very different from the original version, and likely non-functional. The protein will be cut short, ending after the first amino acid. There will be no protein produced at all. No change – the protein will be the same.…
In a study of several families for differences in the sequence of a particular gene suspected to cause a disease. Resulting in the discovery of different mutations in the genes of some families. For each of the mutations, specify if it could change the size or the quantity of mRNA and/or protein product? What kind of change would you predict? Explain each answer briefly. d. AAG378UAG e. promoter mutation. f. one base-pair insertion into codon #765 g. deletion of whole codon #765 h. G-to-A substitution in the 5' UTR i. insertion of 100 base pairs into the fourth intron (this insertion does not alter splicing).
Which type of mutation would expect would have no effect on a protein coding gene in eukaryotes? a.a single base substitution that creates a splice site mutation b.a single base substitution that creates a synonymous mutation c.a single base deletion that creates a frameshift near the 3' end of the open reading frame d.a single base substitution that creates a non-conservative missense mutation e.a single base substitution that creates a conservative missense mutation
A molecular geneticist hopes to find a gene gene in human liver cells that codes for an important blood clotting protein. He knows that the nucleotides sequence of a small part of the gene is GTGGACTGACA. briefly explain how to obtain the desired gene
A small section of bacterial DNA template (anti-sense) strand has the following nucleotide sequence: GTT GTC CAC TCGA mutation in the above sequence involved the deletion of a single base, leading to a shift in the reading frame of the gene, resulting in an incomplete protein. Which of the following gene sequences exemplifies the mutation described above? Select one: a. TT GTC CAC TCG b. GTT GAT CCA CT c. GT ATC CAC TCG d. ATT GTC AC TCG
In the human gene for the beta chain of haemoglobin (the oxygen-carrying protein in the red blood cells), the first 30 nucleotides in the amino-acid-coding region is represented by the sequence: 3'-TACCACGTGGACTGAGGACTCCTCTTCAGA-5'. What is the sequence of the partner strand? 4B. If the DNA duplex for the beta chain of haemoglobin above were transcribed from left to right, deduce the base sequence of the RNA in this coding region.