The main stages of catabolism of biomolecules: proteins, carbohydrates and lipids.

Q: To get all of the amino acids out of the oligopeptide below and into the bloodstream through the…

A: Oligopeptide: Any of the enzymes in the family of proteolytic enzymes, commonly known as proteases,…

Q: b) It's said that secondary structures form because of intra- and intermolecular hydrogen bonding…

A: Examples of secondary structures are alpha-helices and beta-sheets. The primary structure of a…

Q: Compare the principle behind DNA migration in an agarose gel electrophoresis from that of protein…

A: Electrophoresis means the migration of a charged particle under the influence of an applied electric…

Q: Explain the cell response to FED, and then FASTED states, by glucose transporter (GLUT)-4. (answer…

A: Carbohydrate from food is converted to glucose by digestive enzymes which then enters the…

Q: Whether done manually or automated, DNA sequencing gels are always made of polyacrylamide rather…

A: Sequencing DNA entails finding the order of the four chemical building components known as "bases"…

Q: Which of the following amino acids would most likely exhibit hydrophobic interaction with…

A: Amino acids containing non polar side chains are called hydrophobic amino acids.  These include…

Q: 2. The attached figure is a titration curve for the amino acid glycine. At which pH is glycine…

A: Amino acids are biomolecules that have an amino group, a carboxyl group and a side group that is…

Q: Adding a glucose unit to the growing glycogen chain O Requires the production of 1 ATP molecule O…

A: After a meal, there is a surplus supply of glucose in the blood. this causes the pancreas to secrete…

Q: Calculate the resulting equilibrium concentrations of all four species. Express your answers to four…

A: In a general reaction such as: aA + bB ⇌ cC + dD At equilibrium, the concentration of reactants and…

Q: Question 20 of 25 The figure below illustrates what reactions of amino acids? coo C=0 CH₂ CH₂ =0 00…

A: Amino acids are the building blocks of proteins. they exhibit different physical and chemical…

Q: 9. Four molecules of ATP are necessary to convert one OAA to PEP. T F

A: OAA is converted to PEP during gluconeogenesis. Enzyme PEP carboxylase catalyzes this reaction.…

Q: ATP stock (50 µM): Make pre-dilutions with 20, 15, 10, 5, 2,5 and 1,25 µM ATP (1000 μL of each)…

A: Molarity is a way of representing the concentration of a solution. Molarity is the number of moles…

Q: Given that the reduction potential Eo'= -320, +10, +816, and +50mV for NAD+, fumarate, O₂ and…

A: An oxidizing species is the substance that donates electrons, and a reducing species is the…

Q: What is the property/characteristics of DNA that makes it insoluble to ethanol/isopropyl alcohol?

A: The mechanical separation of the nuclear contents from the remainder of the cell, accomplished by…

Q: What charged groups are present in glutamate at a pH = 7? OA) 1× NH3+ B) 1 x COOT C) 1× NH3 and 1 x…

A: Glutamate is an amino acid with molecular formula C5H9NO4. It is considered as acidic amino acid due…

Q: See the oligopeptide below. Compare the quantities of high energy molecules (e.g. ATP/ADP/AMP,…

A: Oligopeptides: It contains from two to twenty amino acids and may be made up of dipeptides,…

Q: vo (μM/min) 25 20 15 10 5 0 7 VO (μM/min) VS pH 8 pH 9.5 10.4

A: Enzymes are  the catalysts that function to increase the rate of reaction by decreasing their…

Q: OH i ACP Suppose that a "snapshot" of FA synthase was taken and the above (drawn) intermediate…

A: The given reaction is from fatty acid biosynthesis that occurs in the cytoplasm. Fatty acid…

Q: The side chain of cysteine contains: OA) a hydroxyl group OB) an amine group C) a carboxyl group OD)…

A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids…

Q: If a dialysis tube that is permeable to water but not sucrose contains a 40% sucrose solution that…

A: Water travels across a semi-permeable membrane from the side of the membrane with a lower…

Q: Will disaccharides and polysaccharides give positive results in Molisch test? How?

A: Molisch’s test is a specific test for the identification of carbohydrates in a sample. The test uses…

Q: What volume of a 0.8 M glucose solution can be made from 50 mL of a 2M stock solution?

A: Stock solution is the given solution present in lab. From the stock solution, we make the working…

Q: 385 What acts as a reductant in the glutamate synthase reaction to catalyze the transfer of the…

A: Reductant is a substance that donates electrons to another substance and reduce it. In an…

Q: Question 21 of 25 What are Gram-negative bacteria? Select the correct response(s): They have a cell…

A:

Q: n which of the test tubes would you say hydrolysis has taken place in this experiment? Why?

A: Enzymes are large molecular weight proteins that catalyse biochemical reactions. The substrate bind…

Q: In glycatysis, conversion of a molecule, of glucose, into 2 Molecules of Pyryvate, results in a net…

A: Glycolysis is the process of conversion of one molecule of glucose to two molecules of pyruvate. A…

Q: a)   Draw    the    A-T    and    G-C    base    pairs.                 - Label    the    bases…

A: DNA are polymers of nucleotides. A nucleotide consists of a nitrogenous base(A, T, G, C) attached to…

Q: Identify the type of chemical reaction. 1 R R 2 Fat / Oil C01695 -R 3 NaOH/H₂O heat Lye Linoleic…

A: Triglycerides are fatty acid esters of glycerols. Fatty acids are carboxylic acids with a long…

Q: 27. While culturing some cells, you lower the temperature of the culture. What happens immediately…

A: Cell membrane are composed of lipid bilayer and proteins. Membrane fluidity depends on the content…

Q: 1. What two enzymes in glycolysis are regulated by high ATP concentrations?

A: INTRODUCTION : Glycolysis : It is a metabolic pathway in which glucose is breaken down into pyruvate…

Q: In the corn snake Pantherophis guttatus, there are several different color variants, including…

A: Introns are non-coding sequences and exons are coding sequences in the gene. Splicing is the process…

Q: -Write down the complementary DNA sequence. TACCTAGCG CACATGTAGGTGGGCAAAGTT -Write down the…

A: Note: Hi! Thank you for the question. We are authorized to answer three subparts at a time. Since…

Q: Write the products of the oxidation and reduction of D-mannose. HO HO H H O || C-H H I -H -ОН -ОН…

A:

Q: Experiment: Action of Bromelain in the Setting of Gelatin Why were the results of the freshly…

A: Bromelain is type of proteolytic enzyme that is found in pineapple. It digests the fibrinogen and…

Q: 1. Explain the stepwise breakdown of starch. 2. Discuss the role of undigestible carbohydrates in…

A: Starch is a polysaccharide, made up of two units; namely amylose (α 1-4 linkage) and amylopectin (α…

Q: a. Provide names for both metabolites. b. What kind of reaction occurs here? c. What enzyme…

A: Biochemical reactions are catalyzed by enzymes in which bio-metabolites are transformed into another…

Q: Which of the following statements is true regarding the classification of amino acids? Group of…

A: Amino acids the building block of polypeptide chain, the alpha carbon of amino acids contains -…

Q: Discuss the role of carbohydrates on cancer and suggest an appropriate treatment

A: Carbohydrates are biomolecules, which are the primary source of energy for the body. All of the…

Q: What is the charge on the following peptide at standard biochemical pH? S-Y-D-F-K-I-V-F-L-L +2 -1 O…

A: Peptides are composed of amino acids. Amino acids are biomolecules with an alpha carbon bonded to an…

Q: Describe the signal transduction pathway for Two or Three of the following: a) ß-adrenergic…

A: Beta adrenergic receptor is a  G-protein-coupled receptor communicating through the Gs alpha…

Q: ● What are the three things we need to know in order to begin to understand the way an active site…

A: Enzymes are high molecular weight proteins that catalyse biochemical reactions. The substrate binds…

Q: Which of the following enzymes requires Mg2+ to carry out its function? Alcohol dehydrogenase.…

A: An enzyme draws substrates to its active site, catalyzes the chemical reaction that creates the…

Q: Now use the equations above and the empirical values below to calculate VO₂ (the rate of oxygen…

A:

Q: NH₂ Methyltransferases NH₂ OH OH S-Adenosylmethionine (SAM) Transamination B Phosphate transfer…

A: Methyl metabolism is well conserved across bacteria to humans. S-Adenosyl methionine (SAM) is…

Q: Experiment 1.2 - Reaction over time 2. Using the standard curve in 1.1, calculate the amount of…

A: The given graph is representing the relation between the absorbance of Product and the concentration…

Q: 1. DNA: ATACGAAATCGCGATCGCGGCGATTCGG mRNA: Codon: Anticodon: Amino Acids:

A: The flow of genetic information from DNA to RNA, RNA to protein synthesis is called central dogma.…

Q: Calculate the number of ATP molecules obtained from the anaerobic conversion of each of the…

A: Anaerobic metabolism is the process in which ATP is produced without oxygen, i.e. ATP is formed by…

Q: QUESTION 5 Oxaloacetate Acetyl-CoA AG" = -7.7 kcal/mol COA Citrate Fatty acids AG"=-1.5 kcal/mol…

A: Free energy change (∆G) of a reaction helps to find the spontaneity of a reaction. Negative ∆G of a…

Q: 10. Which of the following statements regarding insulin is false? A. Insulin is a signal that…

A: When blood glucose concentration increases or decreases, carbohydrate metabolism is coordinated by…

Q: Exergonic and endergonic biochemical reactions; the role of ATP and other macroergic substances in…

A: INTRODUCTION :   ATP - Adenosine triphosphate, it is the main energy currency or units, which is…

Nutrition and diet

We are involved in several daily activities. These actions need a significant quantity of energy. The food we eat provides this energy. Food is necessary for development, repair, and other living activities since it supplies energy. All of these are part of the living practice known as nutrition. Nutrition is the study of nutrients in food, how the body uses them, and the relationship between diet, health, and disease. Nutritionists employ concepts from molecular biology, biochemistry, and genetics to understand how nutrients affect the human body. Nutrition also looks at how people can use their diet to reduce their risk of disease, as well as what happens when they ingest too much or too little of a nutrient and how allergies emerge.