The orientation of the promoter dictates the direction of transcription, and this determines which strand is used as a template. Template strand Terminator Terminator 5' 3' DNA 5' 3' Promoter 1 Promoter 2 Template strand RNA 3' 5' 5' 13' RNA FIGURE 7.11 The Promoter Orients RNA Polymerase The orientation of RNA polymerase determines which strand will be used as the template. In this diagram, the color of the RNA molecules indicates which DNA strand was used as the template. The light blue RNA was transcribed from the red DNA strand (and is therefore analogous in sequence to the blue DNA strand), whereas the pink RNA was transcribed from the blue DNA strand (and is therefore analogous in sequence to the red DNA strand).

The orientation of the promoter dictates the direction of transcription, and this determines which strand is used as a template. Template strand Terminator Terminator 5' 3' DNA 5' 3' Promoter 1 Promoter 2 Template strand RNA 3' 5' 5' 13' RNA FIGURE 7.11 The Promoter Orients RNA Polymerase The orientation of RNA polymerase determines which strand will be used as the template. In this diagram, the color of the RNA molecules indicates which DNA strand was used as the template. The light blue RNA was transcribed from the red DNA strand (and is therefore analogous in sequence to the blue DNA strand), whereas the pink RNA was transcribed from the blue DNA strand (and is therefore analogous in sequence to the red DNA strand).

Name: The light blue RNA strand is complementary to which DNA strand in this
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: The light blue RNA strand is complementary to which DNA strand in this figure? To which DNA strand is the pink RNA strand complementary? The orientation of the promoter dictates thedirection of transcription, and this determineswhich strand is used a

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter29: Transcription And The Regulation Of Gene Expression

Section: Chapter Questions

Problem 2P: The Events in Transcription Initiation Describe the sequence of events involved in the initiation of...

See similar textbooks

Similar questions

Within a promoter, a transcriptional start site isa. located at the –35 sequence and is recognized by σ factor.b. located at the –35 sequence and is where the first base is used as atemplate for RNA transcription.c. located at the +1 site and is recognized by σ factor.d. located at the +1 site and is where the first base is used as a templatefor RNA transcription.
Transcription start site selection by S. cerevisiae Pol II occurs over a range of positions located ~________ bp downstream of the core promoter region. 90 20-25 40-120 6-10
A pre-initiation complex (PIC) is required for transcription to begin. State in which TFII protein has a catalytic function.
Once an RNA polymerase has initiated transcription, it will release the sigma factor or sigma subunit and bind other proteins known as elongation factors before it begins moving down the DNA template doing strand elongation. Briefly explain why this is necessary - why can't RNA polymerase + sigma factor do all of transcription? Be specific.
82Transcription termination takes place downstream from the _______________. A.poly(A) siteb.promoter regionc.5'-m7 G capsD.enhancer sequences 83The core promoter element of RNA polymerase II extends from about 40 bp upstream of the transcription initiation site to about _______ bp downstream from this site. A.100b.1000c.40D.200 84Archaeal and eukaryotic ribosome structure appear to be different from the bacterial ribosome structure. Yesorno
How does the 4 feature of transcription factors namely the structural motifs of DNA binding protein, activation domains, multiple transcription factors and enhancers help in the design of a building block tool. U can use the SrY gene as ur building block tool. Pls explain in details using those features of the transcription factors. In 400 words
Please describe why regulationof transcription frequently involves the promoter and protein interactions with the promoter. Please add details about bacterial promoter properties to discuss RNA polymerase binding to initiate transcription.
The sigma factor protein's role in transcription in E. coli includes which of the following? None of the answer options are correct. plays a role in transcription termination forms part of the core enzyme required for transcription initiation helps the siRNA to bind to the promoter All of the answer options are correct. contributes to the proof-reading activity of RNA polymerase And The role of tRNA is to serve as an intermediate in the decoding of genes. serve as general translational components of the ribosome. facilitate protein trafficking in protein secretion. facilitate splicing of pre-messenger RNAs. act as vehicles bringing amino acids to the site of protein synthesis. None of the answer choices are correct.
The promoter of an operon is the site to which RNApolymerase binds to begin transcription. Certain basechanges in the promoter result in a mutant site towhich RNA polymerase cannot bind. Would you expect mutations in the promoter that prevent binding ofRNA polymerase to act in trans on another copy ofthe operon on a plasmid in the cell, or only in cis onthe copy immediately adjacent to the mutated site?
The following DNA nucleotides are found near the end of a bacterial transcription unit. 3′–AGCATACAGCAGACCGTTGGTCTGAAAAAAGCATACA–5′ a. Mark the point at which transcription will terminate. b. Is this terminator rho independent or rho dependent? c. Draw a diagram of the RNA that will be transcribed from this DNA, including its nucleotide sequence and any secondary structures that form.
The method of Northern blotting is used to determine the amountand size of a particular RNA transcribed in a given cell type.Alternative splicing (discussed in Chapter 14) produces mRNAsof different lengths from the same gene. The Northern blot shownhere was obtained using a DNA probe that is complementary tothe mRNA encoded by a particular gene. The mRNA in lanes 1through 4 was isolated from different cell types, and equal amountsof total cellular mRNA were added to each lane. Explain these results.
The transcription initiation factor “recruited” together with RNA-Pol II in the formation of preinitiation complex is A. TFIIB B. TFIIH C. TFIIF D. TFIIA