The primary eubacterial mRNA transcript (polycistronic) is usually characterized by the presence of: non-transcribed spacers between coding regions introns between non-coding regions transcribed spacers between coding regions introns between coding regions non-transcribed spacers between exons

The primary eubacterial mRNA transcript (polycistronic) is usually characterized by the presence of: non-transcribed spacers between coding regions introns between non-coding regions transcribed spacers between coding regions introns between coding regions non-transcribed spacers between exons

Name: The primary eubacterial mRNA transcript (polycistronic) is usually cha
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: The primary eubacterial mRNA transcript (polycistronic) is usually characterized by the presence of:non-transcribed spacers between coding regionsintrons between non-coding regionstranscribed spacers between coding regionsintrons between coding regio

BIOLOGY:CONCEPTS+APPL.(LOOSELEAF)

10th Edition

ISBN:9781305967359

Author:STARR

Publisher:STARR

Chapter9: From Dna To Protein

Section: Chapter Questions

Problem 15SA: Put the following processes in order of their occurrence during expression of a eukaryotic gene: a....

See similar textbooks

Similar questions

In eukaryotes, which of the following statements is correct with regard to introns and exons? Mature mRNA contains a mix of introns and exons Introns in DNA are removed by spliceosomes Failure to remove introns can lead to production of faulty protein Exons are repeating sequences typically found at the end of a gene Introns are transcribed from promoter sequence
Draw a typical bacterial mRNA and the gene from which it was transcribed. Identify the 5′ and 3′ ends of the RNA and DNA molecules, as well as the following regions or sequences: Q. Protein-coding sequence
All of the following are characteristics of eukaryotic geneexpression excepta) 5' cap is added to the mRNA.b) a poly A tail is added to the 3' end of mRNA.c) introns must be removed to create the mRNA that is translated.d) the mRNA is often polycistronic.e) translation begins at the first AUG.
All of the following are transcribed directly from DNA except: A. proteins B. rRNA c. tRNA d. introns e. exons
The following double stranded segment of DNA is part of a protein coding gene. The segments in uppercase letters (ACTG) represent the exons. The segments in lowercase letters (acgt) represent introns. The lower strand is the template strand that is used by the RNA polymerase to make an RNA transcript. Draw or write-out a) the sequence of the primary transcript and b) the mature mRNA resulting from this stretch of DNA.
Prokaryotic mRNA has some unique features compared to eukaryotic mRNA which of the following would apply only to prokaryotic mRNA and not to eukaryotic mRNA Synthesized in the nucleus Producer by RNA polymerase contains introns polycistronic
Which of the following is true about the three major classes of RNAs in the cell: mRNAs, tRNAs, and rRNAs? A. mRNAs encode polypeptide chains. B. tRNAs are structural components of the ribosome. C. rRNAs are adapter molecules that translate the information on an mRNA into a polypeptide sequence. D. mRNAs can also encode tRNAs and rRNAs.
Occurring in the nucleus ribosome mitochondrion , translation transcription is the process of making an RNA copy from a DNA template. The molecule then enters the cytoplasm. The process in which the mRNA sequence is converted into a sequence of amino acids is called translation transcription . In the cytoplasm, the nucleus ribosome mitochondrion reads the amino acid sequence and assembles the protein.
siRNAs and miRNAs are produced by: Group of answer choices The cutting and processing of double-stranded RNA by Slicer enzymes The cleavage if functional mRNA within cytoplasm The cleavage of RISCs by endonucleases The cleavage of pre-mRNA in the nucleus The cutting and processing of double-stranded RNA by Dicer enzymes
Given the DNA sequence TATAGCACTGAT, which of the following is the correct complementary mRNA sequence that would be produced? TUTUCGUGUCTU AUAUCGUGACUA ATATCGTGACTA CGCATGTCAGC None of the above
Write down the complementary mRNA sequence for each of the following DNA sequence. A: TACCTAGCGCACATGTAGGTGGGCAAAGTT B: TAC ATG GTT ACA GTC TAT TAG ATG CTA TTT ACT TAG
A given coding strand sequence in a Eukaryote is as follows GGGAATATAA GACCGATGGA GGGTACAG CCCTATCAC GATCAGGAGG ATAGCAGCAG Mark the promoter and transcribe from the G after the promoter. Translate the mRNA you made The mRNA made by the cell was 10 nucleotides shorter than what you have made. What could have happened