The relationship between the sequence of DNA bases and amino acids in protein is best stated as ____ The DNA sequence is determined by the amino acid sequence of DNA polymerase The DNA sequence is determined by the amino acids in proteins. The sequence of amino acids is determined by the DNA sequence of a gene

The relationship between the sequence of DNA bases and amino acids in protein is best stated as ____ The DNA sequence is determined by the amino acid sequence of DNA polymerase The DNA sequence is determined by the amino acids in proteins. The sequence of amino acids is determined by the DNA sequence of a gene

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter14: Biotechnology And Society

Section: Chapter Questions

Problem 9QP

See similar textbooks

Similar questions

DNA replication is called semi-conservative because ___ (all, all or none) of the two new strands of DNA is old DNA from the original DNA molecule and ___ (all, all or none) is new DNA.
Which of the following is not a DNA sequence? a. TAG b. AUGAUUCT d. AAAAAAAAAA e. CGG
Which of the following sequences is the best description of the complementary DNA sequence to the following sequence: 5'-CGATTAGC-3' Group of answer choices 5'-GCTAATCG-3' 5'-GCUAAUCG-3' 3'-CGATTAGC-5' 3'-GCUAAUCG-5' 3'-GCTAATCG-5'
An unusual type of DNA helix that is left handed and can form under special conditions in DNA with alternating G and C bases. Group of answer choices 1.Z DNA 2.B DNA 3.A DNA
DNA nucleotides are joined together by blank bonds between the sugar and phosphate groups to make a single dna strand while the two strands of dna that make up the double helix are held to one another by blank bonds
During DNA replication, the enzyme called _______ unwinds the DNA double helix structure, separating the two strands of DNA apart. These two DNA strands serve as templates for synthesis of new DNA. The two strands are held apart by ______ , stabilizing the open "bubble" configuration.
The template strand of a double helical segment of DNA consists of the following sequence: 5’- GTAGCCTTATCTAGCGATCACCGTCCGTATTACTAGTGGCCAGACTCTTTTCACCATGTATAGTTG-3’ Use the given data to answer the succeeding questions and always indicate (and pay attention to) the DIRECTIONALITY of the strands in your answers. Part I. What is the nucleotide order in the complementary DNA strand? Part 2. What is the nucleotide order in the complementary mRNA that can be transcribed from the given DNA strand? Part 3. What will be the overall anticodon sequence in tRNA? Part 4. Following the transitional process, what is the amino acid sequence that will be coded for? Show your answer using ONE-letter amino code starting from N-terminus to C-terminus Part 5. Following translational process, what is the amino acid sequence that will be coded for? Show your answer using THREE-letter amino acid code starting from N-terminus to C-terminus.
A strand of DNA runs the following direction with the following base sequence: 3'-AUG CCC CAG TTA - 5' please note the direction of the strand and the sequence. Give the complimentary sequence of DNA, noting the direction of the sequence.
The DNA base C always pairs with ___
One strand of a DNA molecule contains the base sequence 5'-ACTTGCCA-3'. Write its complementary base sequence.
Which of the following sequences is correct? a. Nucleotides → gene →DNA → Chromosome b. DNA → Chromosomes → Gene → genome c.Nucleotide → DNA → gene → Chromosome d. Genome → gene → DNA → nucleotide
DNA replication follows a dispersive model True or false