h of the following is NOT true of cutting DNA in biotechnology? A molecular biologist can cut DNA using restriction enzymes, DNA can be cut at specific base sequences called recognition sequences. When DNA is cut in such a way that some of the bases are no longer paired with their complements, the unpaired ene If the piece of DNA shown below is cut with an enzyme that cuts at "GGCC", 3 fragments would result. DNA: GTATGACTGAATTCCCAGGCCATCTCCGGA

h of the following is NOT true of cutting DNA in biotechnology? A molecular biologist can cut DNA using restriction enzymes, DNA can be cut at specific base sequences called recognition sequences. When DNA is cut in such a way that some of the bases are no longer paired with their complements, the unpaired ene If the piece of DNA shown below is cut with an enzyme that cuts at "GGCC", 3 fragments would result. DNA: GTATGACTGAATTCCCAGGCCATCTCCGGA

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter13: An Introduction To Genetic Technology

Section: Chapter Questions

Problem 7QP: Cloning Genes Is a Multistep Process The following DNA sequence contains a six-base sequence that is...

See similar textbooks

Similar questions

Cloning Genes Is a Multistep Process The following DNA sequence contains a six-base sequence that is a recognition and cutting site for a restriction enzyme. What is this sequence? Which enzyme will cut this sequence? (See Figure 13.5 for help.) 5 CCGAGGAAGCTTAC 3 3 GGCTCCTTCGAATG 5
Cloning Genes Is a Multistep Process Which enzyme is responsible for covalently linking DNA strands together? a. DNA polymerase b. DNA ligase c. EcoRl d. restriction enzymes e. RNA polymerase
Some restriction enzymes produce DNA fragments with overhanging stretches called sticky ends on each strand. Sticky ends are useful in making recombinant DNA because Select one: a. Sticky ends contain the exact same nucleotides that allows fragments to splice together. b. Sticky ends contain nucleotides with complementary bases that allows fragments to splice together. c. Sticky ends contain the exact same nucleotides that can form hydrogen bonds. d. Sticky ends contain nucleotides with complementary bases that can form hydrogen bonds.
Arrange the following steps in the sequence they would happen in a DNA cloning experiment. a. sealing DNA fragments into vectors with DNA ligase; b. utilizing a probe to detect a clone in the library; c. sequencing the clone's DNA; d. creating a DNA library of clones; e. cutting genomic DNA with restriction enzymes. A. e,a,d,b,c B. a,d,b,c,e C. c,b,e,a,d D. e,d,a,c,b
Which of the following best describes the process of DNA seqencing. a. DNA is seperated on a gel and the different bands are labled with flouroscent nucleotides and scanned with a laser. b. A laser is used to flurorescently label the nucleotides present with in the DNA , the DNA is run on a gel and then the DNA is droken into fragments c. Nucleotides are scanned with a laser and incrprorated into the DNA that has been seperated on a gel and then DNA is amplified with PCR. d. fragments of DNA are produced in a reaction that lables them with any of four different fluroscent dyes and the fragmented then are run on a gel and scanned with laser e. DNA is broken down into its constituents nucleotides and the nucleotides are then run on a gel and purified with a laser
Which of the following most accurately describes the process of DNA cloning? set of laboratory procedures that consist of cutting a segment of DNA with restriction enzymes set of laboratory procedures that uses living cells to mass-produce specific DNA fragments set of laboratory procedures by which a DNA fragment is transferred from a living organism to a SNP chip the manipulation of DNA fragments in a laboratory using modern techniques of molecular biology set of laboratory procedures that consist of isolating of a DNA fragment from a living organism and inserting it into a plasmid
An important feature of restriction enzymes is that each enzyme only recognizes a specific palindrome and cuts the DNA only at that specific sequence of bases. A palindromic sequence can be repeated a number of times on a strand of DNA, and the specific restriction enzyme will cut all those palindromes, no matter what species the DNA comes from. A linear DNA molecule is represented below. The DNA is represented by one line, although in actuality, DNA has two strands. If the DNA molecule has two restriction sites, specifically two repeats of a specific palindrome sequence, A and B, for a specific restriction enzyme: How many fragments would be produced if the DNA is cut by that enzyme? Number each fragment Which fragment would be the largest? Which fragment would be the smallest?
DNA fragments that are 500 bp, 1000 bp, and 2000 bp in length are separated by gel electrophoresis. Which fragment will migrate farthest in the gel? a. The 2000-bp fragment b. The 1000-bp fragment c. The 500-bp fragment d. All will migrate equal distances.
DNA fingerprinting uses a process called gel electrophoresis to separate the fragments of DNA. Once the DNA fragments are sorted, the pattern of bands can be analyzed. Gel Electrophoresis Procedure The smaller DNA fragments start to move away from the wells and the larger DNA fragments remain closer to the wells. An electric current is passed through the gel. DNA fragments are treated with a dye. A restriction endonuclease is added to the DNA. Using micropipettes, the DNA samples are added to the wells. DNA fingerprint is produced. DNA fragments are produced. The order in which a DNA fingerprint is produced using gel electrophoresis is Answer, Answer, Answer, Answer, Answer, Answer, and Answer.
Which of the following describes an advantage of using a recombinant plasmid for DNA cloning over PCR? A. PCR is more likely to have errors introduced in the copying process. B. Recombinant DNA plasmids are able to create large amounts of copies more quickly than PCR. C. PCR can only be conducted in eukaryotic cells. D. PCR requires prior knowledge of the sequence in question, while a recombinant plasmid does not.
When joining two or more DNA fragments, a researcher can adjust the sequence at the junction in a variety of subtle ways, as seen in the following exercises.(a) Draw the structure of each end of a linear DNA fragment produced by an EcoRI restriction digest (include those sequences remaining from the EcoRI recognition sequence).(b) Draw the structure resulting from the reaction of this end sequence with DNA polymerase I and the four deoxynucleoside triphosphates.(c) Draw the sequence produced at the junction that arises if two ends with the structure derived in (b) are ligated (d) Draw the structure produced if the structure derived in (a) is treated with a nuclease that degrades only single-stranded DNA.(e) Draw the sequence of the junction produced if an end with structure (b) is ligated to an end with structure (d).(f) Draw the structure of the end of a linear DNA fragment that was produced by a PvuII restriction digest (include those sequences remaining from the PvuII recognition…
In next-generation sequencing, which of these advances allows for massively parallel sequencing? a. Pieces of DNA are fixed to a surface, so we can tell which new nucleotides were added to each piece. b. DNA sequences are read in real-time as nucleotides are added to each piece. c. Each segment of the genome can be pieced back together through shotgun alignment d. Single molecules of DNA can be read without the need for amplification.