the RHR, OHR, and the balanced overall reaction of the voltaic cell
Q: The synthesis reactions happen in the daytime, but are sometimes called "dark" reactions because…
A: Answer: PHOTOSYNTHESIS = It is the biological process in plants wher they require sunlight as the…
Q: In this setup, the rate of the reaction can be increased by
A: Photosynthesis is the process by which plants synthesize their own food in the presence of sunlight.…
Q: In an experiment where you use different concentrations of avocado catalase to determine how that…
A: In this experiment, the effect of concentration of avocado catalase on the rate of reaction with…
Q: Given on the image is the pathway wherein I is for intermediate, P is for pathway name and E is for…
A: The given figure shows an interconnected pathway where various products & enzymes of different…
Q: Please explain what happened in the reaction. How did H2SO4 and 3H2O reacted with the glucose?
A: Carbohydrates are polyhydroxy aldehydes or ketones or compounds that yield them on hydrolysis.…
Q: Describe several general ways that Ab-Ag reactions are detected.
A: Antigens are the protein molecules capable of inducing an immune response. Antibodies…
Q: what is the Km for the following enzyme michael menten
A: Michaelis menten constant, Km is the substrate concentration required to produce half maximum…
Q: why would the reaction of amylase and starch increase if the reaction temperature of amylase…
A: Enzymes are made of proteins and each enzyme have an optimal value of temperature and pH at which it…
Q: How would you describe the three different types of phosphorilation?
A: Phosphorylation is a biological procedure that involves the addition of a phosphate group to a…
Q: These are Methyl Red reactions. Describe the reactions in Tubes A (left) and B (right). What type of…
A: Methyl Red is used as a pH indicator in both the test tube and it helps to indicate the reaction…
Q: Given the following reaction, identify the class of the enzyme in CH20-PO, 2- CH,OH он O. OH OH OH…
A: Enzymes are biocatalysts that speed the reactions by decreasing the activation energy of the…
Q: Which of the following reactions is feasible at pH 7 ? And, why? FAD + NADH + H+ FADH2 + NAD+ FADH2…
A: Nicotinamide adenine dinucleotide (NAD) and Flavin adenine dinucleotide (FAD) are coenzymes derived…
Q: the cell potential table found in the Reference Material, why do you get holes in your aluminum…
A: The natural process that results in the conversion of a reactive metal into a stable metal by…
Q: If the DGO for X --> Y = -11.5, what is the net DG° for the following? Y+ ADP --> X+ ATP Please do…
A: Note: Since you have posted multiple independent questions in the same request, we will solve the…
Q: Under standard conditions, will the following reaction proceed spontaneously as written? Fumarate +…
A: A spontaneous processes is one that occurs without the addition of external energy. A spontaneous…
Q: why does the rate of reaction level off at 6.0%
A: Answer: Introduction: Enzymes are bio-catalyst that increases the rate of a chemical reaction…
Q: Can you please draw the mechanism of phosphorylation (all intermidiate steps) and indicate which one…
A:
Q: write chemical equation showing the breakdown of lactose. above the arrow indicate the enzyme that…
A: Introduction: A sugar made out of galactose and glucose subunits is lactose and has the molecular…
Q: at is the difference between and endergonic reaction and an exergonic reaction? What is an example…
A: Many different biochemical reactions take place inside living organisms.
Q: If you wanted to figure out what the optimum temperature is for catalase, how would you set up your…
A: Hi! Thank you for the questions. As you have posted multiple questions, I will be answering the…
Q: A biochemical reaction will proceed in the direction as written if: Group of answer choices H > 0. G…
A: The thermodynamical properties such as free energy change, enthalpy change, and entropy change…
Q: Give an electrophilic addition reaction involving a coenzyme
A: Electrophilic addition reaction is an addition reaction where a chemical compound containing a…
Q: What were the names of the substrate, enzyme, product, and substrate isomer? What the potato extract…
A: Substrate: - The pre reaction substance about to be metabolized.Enzyme: - The catalyst which either…
Q: Why we use glutaraldehyde in production of biomaterials ? What can we use instead of glutaraldehyde?
A: In the field of biomaterials, there is a combination of medicine, physics, biology, and chemistry.…
Q: For questions 25-27, please use the diagram above. What reaction is being displayed ahove?
A: INTRODUCTION The TCA cycle is an amphibolic pathway. Anaplerotic reactions replenish TCA cycle…
Q: A sample of hydrogen peroxide solution has a mass of 4.599 g. After reacting with the enzyme…
A: Hydrogen peroxide is a generally mild antiseptic helped the skin to affect infection of small cuts…
Q: Catechol, a substance found in plants, reacts with oxygen to produce benzoquinone and water. The…
A: Enzymes are proteins that act on specific molecules called substrates, and result in formation of…
Q: Use the graph below to determine which of the following is the optimal pH 100 80 60 for catalase. 40…
A: Enzymes: It is a biocatalyst that increases the rate of reaction by lowering activation energy.…
Q: Write chemical equation intramolecular dezamination Serineу. Specify enzymes and co-enzymes for…
A: Amino acids Proteins are the polymers of nitrogenous compounds called amino acids. Each amino acid…
Q: a Mixture of the following amino acids is subjected to paper electrophoresis: Gly, Arg and Asp.…
A: The molecules in a mixture are separated by exploiting their chemical or physical difference. At a…
Q: DIY Glue State the materials that use to make it. Show the mechanisms of the reaction that occur.
A: The materials necessary for the preparation of glue are as follows: 12 cup of skim (non fat) milk 1…
Q: Given on the image is the pathway wherein I is for intermediate, P is for pathway name and E is for…
A: Carbohydrate metabolism is the central metabolic pathway that involves the metabolic synthesis and…
Q: What is the difference between and endergonic reaction and an exergonic reaction? What is an example…
A: Reactions takes place when one or more reactants react with each other to form a product. Some…
Q: Label the image with the following terms: active site, reactant, enzyme.
A: Enzymes permit numerous chemical reactions to happen inside the homeostasis imperatives of a living…
Q: Which of the following is the best description of the process shown in the image below?
A: 3rd option is correct.
Q: Name the phase of this reaction and Label the diagram Note fand I are locations AD H
A:
Q: DCPIP (2,6-dichlorophenol-indophenol), a blue dye, can act as an electron acceptor and becomes…
A: DCPIP ( full form- 2,6 dichlorophenol indophenol ) is a dye in this experiment it works as an…
Q: What are the optimal conditions for an enzyme(full answer)?
A: Since you have asked multiple question, we will solve the first question for you. If you want any…
Q: Complete the pathway below by writing the intermediate (I) name, pathway name (P) and enzyme (E)…
A: 1.P- Glycogenolysis 2.P- Glycogen synthesis 3.I- Glucose-6-phosphate 4.P- Pentose phosphate pathway…
Q: Use the data from the table below to answer the questions on an ezyme obtained from potato extract.…
A: Enzyme activity is regarded as the amount of enzyme that will be required to convert 1 mole of a…
Q: Define the following terms: a. autotroph b. chemoautotroph c. photoautotroph d. photoheterotroph e.…
A: Nutrients are the substances which provide energy and biomolecules necessary for carrying out the…
Q: The total energy in linoleic acid is 2,520 kcal/mol and the total amount of ATP that can be…
A: Introduction: Linolenic acid is a type of fatty acid. Linolenate (in the form of esters of linolenic…
Q: Explain how would you go about identifying the active site residues in the laboratory
A: Active site is defined as the enzyme region where substrates bind and lead a reaction. The active…
Q: • From the figure below, identify the missing initial reactants and final products by filling in the…
A: Glycolysis is a pathway which breaks down glucose into two three carbon compounds and generates…
Q: Write the complete balanced equation for our fermentation reaction.
A: Fermentation is a process that involves enzymatic catabolism of organic compounds (mainly…
Q: Identify the two cellular process responsible for products described in the figure. Explain the role…
A: Every organism requires energy for growth and survival. The energy is obtained from the food. There…
Q: Which of the following represents a synthesis reaction? Multiple Choice AB +XY + AY+ XB AB A+B AB +…
A: In biological system the enzymes are responsible for doing the chemical reactions in a cells. The…
Write the RHR, OHR, and the balanced overall reaction of the voltaic cell. To determine OHR and RHR, look at the columns labeled as Anode and Cathode.
Step by step
Solved in 2 steps with 2 images
- genetics, pleaseeee solve parts g and hOur lives are surrounded byBig Data. Enormous quantitiesof personal informationare stored on private and public databases,revealing our purchasing preferences,search engine histories, social contacts,and even GPS locations.Perhaps the most personal of all BigData entries are genome sequences.Tens of thousands of individuals arenow donating DNA for whole-genomesequencing—by both private genesequencingcompanies and public researchprojects. Most people who donatetheir DNA for sequence analysis do sowith little concern. After all, what consequencescould possibly come fromaccess to gigabytes of As, Cs, Ts, and Gs?Surprisingly, the answer is—quite a lot.One of the first inklings of geneticprivacy problems arose in 2005, whena 15-year-old boy named Ryan Kramertracked down his anonymous spermdonorfather using his own Y chromosomesequence data and the Internet.Ryan submitted a DNA sample to a genealogycompany that generates Y chromosomeprofiles and puts people intocontact with others who share…Perform Progressive Alignment Method on the following 5 sequences and findthe best multiple sequence alignments.Sequence # 1: ATCCAATTTTSequence # 2: ACTGACCSequence # 3: ATGGCCATTSequence # 4: ATCTTCTTSequence # 5: ATTGCCATT
- With regards to this sequence below please answer this quistions 1) What is the format of the sequence below and why 2) What do you understand by a query sequence 3) What is the sequence size of this sequence 4) What is the ID of the sequence and indicate the taxonomic rank of the ID ATGAAAAAACGAAAAGTGTTAATACCATTAATGGCATTGTCTACGATATTAGTTTCAAGCACAGGTAATT TAGAGGTGATTCAGGCAGAAGTTAAACAGGAGAACCGGTTATTAAATGAATCAGAATCAAGTTCCCAGGG GTTACTAGGATACTATTTTAGTGATTTGAATTTTCAAGCACCCATGGTGGTTACCTCTTCTACTACAGGG GATTTATCTATTCCTAGTTCTGATAGAAAATATTCCATCGGAAAACCAATATTTTCAATCTGCTATTTGG TCAGGATTTATCAAAGTTAAGAAGAGTGATGAATATACATTTGCTACTTCCGCTGATAATCATGTAACAA TGTGGGTAGATGACCAACAAGTGATTAATAAAGCTTCTAATTCTAACAAAATCAGATTAGAAAAAGGA AGATTATATCAAATAAAAATTCAATATCAACGAGAAAATCCTACTGAAAAAGGATTGGATTTCAAGTTGT ACTGGACCGATTCTCAAAATAAAAAAGAAGTGATTTCTAGTGATAACTTACAATTGCCAGAATTAAAACA AAAATCTTCGAACTCAAGAAAAAAGCGAAGTACAAGTGTGGACCTACGGTTCCAGACCGTGACAATGAT GGAATCCCTGATTCATTAGAGGTAGAAGGATATACGGTTGATGTCAAAAATAAAAGAACTTTTCTTTCAC…Price et al. [(1999). J. Bacteriol. 181:2358–2362] conducteda genetic study of the toxin transport protein (PA) of Bacillusanthracis, the bacterium that causes anthrax in humans. Withinthe 2294-nucleotide gene in 26 strains they identified five pointmutations—two missense and three synonyms—among differentisolates. Necropsy samples from an anthrax outbreak in 1979revealed a novel missense mutation and five unique nucleotidechanges among ten victims. The authors concluded that thesedata indicate little or no horizontal transfer between differentB. anthracis strains. Question: Which types of nucleotide changes (missense or synonyms)cause amino acid changes?Price et al. [(1999). J. Bacteriol. 181:2358–2362] conducteda genetic study of the toxin transport protein (PA) of Bacillusanthracis, the bacterium that causes anthrax in humans. Withinthe 2294-nucleotide gene in 26 strains they identified five pointmutations—two missense and three synonyms—among differentisolates. Necropsy samples from an anthrax outbreak in 1979revealed a novel missense mutation and five unique nucleotidechanges among ten victims. The authors concluded that thesedata indicate little or no horizontal transfer between differentB. anthracis strains. Question: On what basis did the authors conclude that evidence ofhorizontal transfer is absent from their data?
- Price et al. [(1999). J. Bacteriol. 181:2358–2362] conducteda genetic study of the toxin transport protein (PA) of Bacillusanthracis, the bacterium that causes anthrax in humans. Withinthe 2294-nucleotide gene in 26 strains they identified five pointmutations—two missense and three synonyms—among differentisolates. Necropsy samples from an anthrax outbreak in 1979revealed a novel missense mutation and five unique nucleotidechanges among ten victims. The authors concluded that thesedata indicate little or no horizontal transfer between differentB. anthracis strains. Question: What is meant by ”horizontal transfer”?Download BLOSUM30 and BLOSUMB0 substitu- tion matrices and place them side by side on your computer screen. What are the differences between the two matrices? Why do you see these differences?Which of the following pairs of sequences would be considered different alleles in DNA profiling? a) ATGAATTCGG; ATGAAATCGG b) ATGAATTCGG; TACTTACTTACT c) GAAGAAGAA; GAAGAAGAAGAA d) AATAATAATAAT; AATTAATTAATT
- Diamond–Blackfan anemia (DBA) is a rare, dominant geneticdisorder characterized by bone marrow malfunction, birthdefects, and a predisposition to certain cancers. Infants withDBA usually develop anemia in the first year of life, have lower thannormal production of red blood cells in their bone marrow, and havea high risk of developing leukemia and bone cancer. At the molecularlevel, DBA is caused by mutations in any one of 10 genes thatencode ribosomal proteins. The first-line therapy for DBA is steroidtreatment, but more than half of affected children develop resistanceto the drugs and in these cases, treatment is halted. DBA canbe treated successfully with bone marrow or stem cell transplantsfrom donors with closely matching immune system markers. Transplantsfrom unrelated donors have significant levels of complicationsand mortality. A couple with a child affected with DBA undergoes in vitro fertilization (IVF) and genetic testing of the resulting embryos to ensure that the embryos…Please help with all of these! thank you so much! Neutral regions of a species’ genome that are distant from any selected sites have apairwise diversity (?) of 0.01. Other regions of the genome have reduced genetic variation,and selective sweeps could be responsible for the reduction. Assume that selective sweepshappen at a rate of 10^-10 per bp, and they take 500 generations to reach fixation. Therecombination rate in regions where selective sweeps might occur is 10^-8 per bp. Theeffective population size of the species is 10^5. A. Find the expected genetic diversity (? per bp) in regions where selective sweepsmight be occurring.B. Find the deleterious mutation rate (per bp) that would be required to produce anequivalent reduction in genetic diversity as a result of background selection (BGS)?Assume the same recombination rate as above.Using the skills you learnt in the DNA Analysis tutorial, correctly identify the gene and the species of the following DNA sequence: AACCAGTGTGCTGCAGGCTGCACAGGCCCCCGGGAGAGCGACTGCCTGGTCTGCCGCAAA Using the skills you learnt in the DNA Analysis tutorial, correctly identify the gene and the species of the following DNA sequence: AACCAGTGTGCTGCAGGCTGCACAGGCCCCCGGGAGAGCGACTGCCTGGTCTGCCGCAAA Gene: RNA Polymerase I. Species: Homo Sapiens Gene: Epidermal Growth Factor Receptor (EGFR). Species: Homo Sapiens Gene: DNA Polymerase II. Species: Mus Musculus Gene: Insulin Receptor (INSR). Species: Homo Sapiens