Explain all of the options Your answer-is inoThe correct answer is: 1,2,3,5,4Which of the following is FALSE about "classic" transposons and retrotransposons?Ac is an autonomous transposable element because in contains all necessary sequences and codes for the enzymeneeded for transpositiona.O b. retrotransposons use reverse transcriptase and other enzymes to move from one location to anotherboth transposons and retrotransposons generate a short direct repeat in the region of DNA where they insertС.themselvesO d. retrotransposons have inverted repeats at the end of the transposable elementO e.transposons use the enzyme transposase to move from one location of the genome to anotherThe correct answer is: retrotransposons have inverted repeats at the end of the transposable element

Barbara McClintock discovered two classes of controlling elements in maize plant known as…

Which of the following is FALSE about "classic" transposons and retrotransposons? Ac is an autonomous transposable element because in contains all necessary sequences and codes for the enzyme needed for transposition a. b. retrotransposons use reverse transcriptase and other enzymes to move from one location to another O C. both transposons and retrotransposons generate a short direct repeat in the region of DNA where they insert themselves d. retrotransposons have inverted repeats at the end of the transposable element e. transposons use the enzyme transposase to move from one location of the genome to another

Which of the following is FALSE about "classic" transposons and retrotransposons? Ac is an autonomous transposable element because in contains all necessary sequences and codes for the enzyme needed for transposition a. b. retrotransposons use reverse transcriptase and other enzymes to move from one location to another O C. both transposons and retrotransposons generate a short direct repeat in the region of DNA where they insert themselves d. retrotransposons have inverted repeats at the end of the transposable element e. transposons use the enzyme transposase to move from one location of the genome to another

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter29: Transcription And The Regulation Of Gene Expression

Section: Chapter Questions

Problem 13P

See similar textbooks

Similar questions

Yes or no? DAPI just stains dna in testes and sperm of planarian. A of riboprobe duryin situ hybridization pair with T's in mrna . T with A, cwith G and G with C. in forward genetics phenotype is known before the gene mutation and in reverse genetics the altered gene is known before phenotype
Please explain it simply, and don't over-explain. Thanks! A. How can DNA be used to pass on inheritable material & make proteins?
The modular nature of eukaryotic activator proteinsgave scientists an idea for a way to find proteins thatinteract with any particular protein of interest. Theidea is to use the protein–protein interaction to bringtogether a DNA-binding region with an activation region, creating an artificial activator that consists oftwo polypeptides held together noncovalently by theinteraction.The method is called the yeast two-hybrid system,and it has three components. First, the yeast contains areporter gene construct in which UASG (an enhancerlike sequence that binds the activator Gal4 as describedin Problem 8) drives the expression of an E. coli lacZreporter (encoding the enzyme ß-galactosidase) from ayeast promoter. Second, the yeast also expresses a fusion protein in which the DNA-binding domain of Gal4is fused to the protein of interest; this fusion protein iscalled the bait. The third component is a cDNA librarymade in plasmids, where each cDNA is fused in frameto the activation domain of…
Hi all, If I could have questions 4-10 answered that would be perfect. GTTTTCACTGGCGAGCGTCATCTTCCTACT 1. Identify the gene from which the query sequence originates (Name of the gene)2. Provide the FULL protein sequence encoded by the gene.3. Are different splice variants known for this gene?4. What human disease has been connected to this gene?5. Calculate molecular weight (kiloDalton, kD) and calculated pI (the pH where theprotein carries no net electrical charge) of the protein.6. Provide the reference (in proper reference form: Author; Year; Title; JournalName; Volume; Page Numbers) for a recent publication involving the identifiedgene. This reference should NOT be a web page reference.7. Are there homologs for the identified gene in other systems? Identify one homolog in an invertebrate system (if there is none, provide a vertebratehomolog).8. What is the function (e.g. transcriptional regulation, transmembrane signaling,kinase, protease, etc.) of the protein(s) encoded by the…
Need help 1.The RNAs acting in RNAi are about 18 nucleotides long. To judge whether it is possible to uniquely target a particular gene with an RNA of this size, consider the following calculation: what is the expected frequency of occurrence of a specific 18 nucleotide sequence? a.The probability of finding this sequence is ___ . b.Therefore, the frequency of occurrence of this sequence is one in ___ nucleotides. c.The fruit fly genome consists of 1.2×108 base pairs.Using the logic in part a., calculate the minimum length of a unique DNA sequence expected to occur by chance just once in the fruit fly genome. Length = __ base pairs
Please explain it simply, and don't over-explain. Thanks! A. How is DNA structure arranged to allow it to do its function?
97Which of the following is examples of a transposable element found in bacteria? (multiple choice questions)A.IS903b.Tn5c.IS1D.Xis 98What is the key component of the catalytic site of the spliceosome? (multiple choice questions)A.DNAb.ribosomesc.proteinD.RNA 99Which antibiotic can binds to RNA polymerase and blocks an early step in RNA synthesis?A.Ampicillinb.Chloramphenicolc.RimantidineD.None of the above 100All tRNA molecules have poly (A) tails at their 3' end. Yesorno
Pinker mentions that only 1% of the human genome codes for proteins (the rest included introns, regulatory sequences, and repetitive DNA, some of it parasitic—we will talk about this later). Given that the human genome contains 3 x 109 base-pairs of DNA, there are about 20,000 human genes, and three base pairs code for each amino acid in a protein, how many amino acids are in the average human protein? [Hint: start with what fraction of base pairs in the human genome code for proteins.]
ANWER FAST NO NEED FOR LONG EXPLANATION 1. In the sugar-phosphate backbone of DNA, the phosphate group is located in the 3’ end while the deoxyribose is present in the 5’ end. Select one: True False 2. Not all missense mutations will lead to nonfunctional proteins. It all depends on where the substitution lies in the polypeptide chain and how it will affect protein folding and activity. Select one: True False 3.What component(s) is/are involved in transcription? a.Sigma factor b.RNA polymerase c.Promoter d.B and C e.All of the above
Homologous Recombination, Heteroduplex DNA, and Mismatch Repair Homologous recombination in E. coli leads to the formation of regions of heteroduplex DNA. By definition, such regions contain mismatched bases. Why doesnâ€™t the mismatch repair system of E. coli eliminate these mismatches?
Give one chromosome and show its value after mutation - 8 Quean problem
Q1: How many codons code for isoleucine? For tryptophan? For leucine? Q2: What codons are associated with asparagine? With serine? Q3: From the partial mRNA sequence that you speciﬁed in Figure 10.6’s question 3 as being transcribed from the DNA template strand, remove only the ﬁrst A. What amino acid sequence would be translated as a result of this change? How does that sequence compare to the amino acid sequence you translated from the original mRNA sequence?