Give 1 example of diseases arising from each of the following mutations and explain each.Point mutationFrameshift mutationCalculate for the DNA concentration. The absorbance at 260 nm is 0.7 at 1:30 dilution; the absorbance at 320 nm is 0.1. Is the DNA isolated of good quality? The absorbance at 260 nm is 0.7; the absorbance at 280 nm is 0.1; the absorbance at 320 is 0.01. If you do an absorbance reading after plasmid purification and get an A260/A280 of less than 1.8, how could you further purify the sample to get rid of the protein contamination? Is it always necessary to have completely pure DNA? What are some cases where it would or would not be?

Name: Give 1 example of diseases arising from each of the following mutation
Uploaded: 2024-03-20T06:42:55.000Z
Channel: Bartleby
Description: Give 1 example of diseases arising from each of the following mutations and explain each.Point mutationFrameshift mutationCalculate for the DNA concentration. The absorbance at 260 nm is 0.7 at 1:30 dilution; the absorbance at 320 nm is 0.1. Is the D

mutations are any alternations in genetic sequence in the dna . mutations cause change in the…

Answered: Give 1 example of diseases arising from…

Science

Biology

Give 1 example of diseases arising from each of the following mutations and explain each. Point mutation Frameshift mutation

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter11: Genome Alterations: Mutation And Epigenetics

Section: Chapter Questions

Problem 9QP: Define and compare the following types of nucleotide substitutions. Which is likely to cause the...

See similar textbooks

Similar questions

Is each of the following mutations a silent, missense, nonsense, orframeshift mutation? The original DNA strand is 5′–ATGGGACTAGATACC–3′. (Note: Only the coding strand is shown; the firstcodon is methionine.)A. 5′–ATGGGTCTAGATACC–3′B. 5′–ATGCGACTAGATACC–3′C. 5′–ATGGGACTAGTTACC–3′D. 5′–ATGGGACTAAGATACC–3′
We run the HinDIII-digest of lambda-DNA as the standard ladder on the gel.Number the largest fragment as band #1, the next largest as band #2, etc. How would the slowest band from the HinDIII-digest of pGLO align with the the bands of the ladder? 1) Even with band #1. 2) Even with band #2. 3) Even with band #3. 4) Even with band #4. 5) Even with band #5. 6) Even with band #6. 7)Even with band #7. 8) Between bands #1 and #2, 9) Between bands #2 and #3, 10) Between bands #3 and #4, 11)Between bands #4 and #5, 12) Between bands #5 and #6, 13) Between bands #6 and #7,
The accompanying photo shows a sequencing gel from the original study that first sequenced the cystic fibrosis gene (J. R. Riordan et al. 1989. Science 245:1066–1073). From the photo, determine the sequence of the normal copy of the gene and the sequence of the mutated copy of the gene. Identify the location of the mutation that causes cystic fibrosis. (Hint: The CF mutation is a 3-bp deletion.)
What is the role of alcohol in extracting DNA? 1.DNA is a polar molecule with an overall negative charge, and as such is not soluble in alcohol, and therefore precipitates. 2.DNA is a polar molecule with an overall positive charge, and as such is not soluble in alcohol, and therefore precipitates. 3.DNA is a non polar molecule with an overall negative change, and as such is soluble in alcohol, and therefore precipitates. 4.DNA is a polar molecule with an overall positive change, and as such is soluble in alcohol, and therefore precipitates.
The following is a list of mutational changes. For eachof the specific mutations described, indicate which ofthe terms in the right-hand column applies, either as adescription of the mutation or as a possible cause.More than one term from the right column can applyto each statement in the left column.1. an A–T base pair in the wild-type gene ischanged to a G–C pair2. an A–T base pair is changed to a T–A pair3. the sequence AAGCTTATCG is changed toAAGCTATCG4. the sequence CAGCAGCAGCAGCAGCAGis changed toCAGCAGCAGCAGCAGCAGCAGCAG5. the sequence AACGTTATCG is changed toAATGTTATCG6. the sequence AACGTCACACACACATCGis changed to AACGTCACATCG7. the sequence AAGCTTATCG is changed toAAGCTTTATCGa. transitionb. basesubstitutionc. transversiond. deletione. insertionf. deaminationg. X-rayirradiationh. intercalatori. slippedmispairing
Below are 9 possible primer pairs.● Determine which primer pair is the best choice.● Explain why the other primers are not good choices.● Calculate the Tm for each primer. Underline or highlight the region of DNA for the primer pair you chose as the best.Forward 1: 5’ gaaataattttgtttaactttaag 3’ Tm =Reverse 1: 5’ gtttaagacaaaatagtctgg 3’ Tm =Forward 2: 5’ gtaactcagctttcaggtcg 3’ Tm =Reverse 2: 5’ tctcggaatgttgcaacagc 3’ Tm =Forward 3: 5’ agattagcggatcctacctg 3’ Tm =Reverse 3: 5’ atgtgtaatcccagcagcag 3’ Tm =Forward 4: 5’ cattgattatttgcacggcg 3’ Tm =Reverse 4: 5’ aaaatcttctctcatccgcc 3’ Tm =Forward 5: 5’ tccataagattagcggatcc 3’ Tm =Reverse 5: 5’ tgcaagcttggctgttttgg 3’ Tm =Forward 6: 5’ gatcctacctgacgcttttta 3’ Tm=Reverse 6: 5’ aaataatgaattcgagctcggt 3’ Tm =Forward 7: 5’ataaaaaaatcgagataaccgtt 3’ Tm =Reverse 7: 5’aggtcgactctagaggatc 3’ Tm =Forward 8: 5’ctacctgttccatggccaac 3’ Tm=Reverse 8: 5’ ttcgggcatggcactcttg 3’ Tm=Forward 9: 5’ tccataagattagcggatcc 3’ Tm =Reverse 9: 5’…
a)Dr. Thisisaneasyexam decides to amplify a gene from a plasmid using PCR. She starts out with 6.6 x 10-14g of a 10 kb template in a 100 µl reaction. Assuming that the molecular weight of the average base pair is 660 Daltons calculate the number of molecules of the template. b)Given that the concentration of each primer (20 base pairs each) is 0.1µM in this same reaction volume (100 µl) calculate the number of molecules of the primer present
For the following short sequence of double stranded DNA and the given primers, there will be one major duplex DNA product after many cycles (imagine 10 cycles) of PCR. Provide the sequence of this one major duplex product and label the 5’ and 3’ ends of each strand. Sequence to be amplified: 5’- GGTATTGGCTACTTACTGGCATCG- 3’ 3’- CCATAACCGATGAATGACCGTAGC- 5’ Primers: 5’-TGGC-3’ and 5’-TGCC-3’
Is each of the following mutations a transition, transversion, addition,or deletion? The original DNA strand is 5′–GGACTAGATAC–3′(Note: Only the coding DNA strand is shown.)A. 5′–GAACTAGATAC–3′B. 5′–GGACTAGAGAC–3′C. 5′–GGACTAGTAC–3′D. 5′–GGAGTAGATAC–3′
The letters ABCDEFGH represent a normal DNA sequence. Indicate the type of mutation present in each of the following situations: a) ABCCDEFGH b) ABCDEGH
Look at the double-stranded segment of DNA shown below. Imagine that the two strands have already been denatured, and the temperature has been decreased to an appropriate annealing temperature. Show where the two primers would anneal to the strands, then indicate the direction of extension on each new strand with an arrow. 5’--T C A G G A C G T A A G C T T G C A T A T C T C G A T G C T A A A T C A T—3’ 3’--A G T C C T G C A T T C G A A C G T A T A G A G C T A C G A T T T A G T A—5’ Primer #1: 3’ A C G A T T T 5’ Primer #2: 5’ G G A C G T A 3’
In order to determine the purity of a DNA sample. spectrophotometry can be carried out at _______ to measure DNA, and _______ to measure protein. The ratio _______ is then calculated, and a number between _______ indicates higher purity. 280 nm; 260 nm; A280/A260; 0.5-1 260 nm; 280 nm; A260/A280; 0.5-1 260 nm; 280 nm; A260/A280; 1.5-2 260 nm; 280 nm; A280/A260; 1.5-2