To predict: The organs that can be affected before opening the abdominal cavity.

Q: What is the role of dendritic cells in the innate immune system?

A:

Q: describe the likely pathway a dsRNA takes after being eaten in order for an RNAi effect to be passed…

A: The dsRNA enters the cells as the embryo develops. Through all stages of development this method…

Q: catalyzes the reaction that creates creatine phosphate in skeletal muscle   A Creatine phosphatase…

A: Creatine phosphate is the main high-energy, phosphate-storage molecule of muscle.It is primarily…

Q: Match the term in column A with its description in column B

A: The terms are correctly matched with the contents below

Q: So why the barr bodies cannot be seen in the experiment?

A: Each organism's DNA sequence is unique. Its base-pair sequence might vary from time to time. It is…

Q: Air sae comection with - humerus bone Humenus bone Branchus 4 Heart 6 7 8. Tail

A: As we know that like humans , animals are also composed of different cell types . Group of cells…

Q: Male spotted bugs often allow the female to eat them during mating. You are a scientist studying…

A: From the graph it can be concluded that the average number of eggs are much more when males are…

Q: Below the chicken body is given, Indicate the unknown parts shown below Head Air sac connection with…

A: The chicken (Gallus domesticus) is a domesticated subspecies of the red junglefowl with…

Q: what part is pointed in letter D?

A: Introduction A cell is a cytoplasmic mass that is outwardly bound by a cell membrane. Cells are the…

Q: To test evolutionary hypotheses, you make a phylogeny of a group of organisms based on six traits: -…

A: The phylogenetic tree is given in the question. The phylogenetic tree depicts the relationship…

Q: Name the method that would be used for each of the following: listening to a patient for a heart…

A: Introduction  Heart murmurs are sounds generated by turbulent blood in or near your heart, such as…

Q: here is a hypothetical gene related to the nervous system of Drosophila. Describe all the methods,…

A: In situ hybridization (ISH) is a type of hybridization that uses a labeled complementary DNA, RNA or…

Q: can you please explain the last part of step 2 further? Specifically this  "The complementation…

A: Complementation is a relationship between mutations in an organism that helps us determine that the…

Q: nscript: 3' TACAGTTAAGGCTCCACTGTTA 5' 5' 3' ino Acid Sequence (ex. Met-Trp- and so on) Second letter…

A: The genetic code is the relationship between the sequence of bases in DNA and the sequence of amino…

Q: The development of DNA technology is bringing profound changes to science, agriculture and…

A: Introduction DNA technology is an extremely important research tool in biology as it allows the…

Q: Use a phenomenon to explain how materials (water, glucose, oxygen/carbon dioxide) pass thru the cell…

A: Introduction The movement of materials across cell membranes is known as cell transport. Passive and…

Q: Describe the way gibberellin causes plant growth

A: Gibberellin or Gibberellic acid are the groups of hormones present in plants. In-plant it is…

Q: Choose which does NOT belong to the group then give the commonality of the remaining 3 terms 1.…

A: In plants; each part have different roles to play for the proper development of plants.

Q: What molluscan features can be seen in other invertebrate phyla? Explain.

A: The animals belonging to the phylum Mollusca have soft-bodies, triploblastic and bilaterally…

Q: To determine: The effect of calcitonin on blood calcium levels when the release of this hormone is…

A: In biology, homeostasis refers to the state of consistent internal, physical, and chemical…

Q: 1. Male and female animals have a pair of gonads. What advantages does it provide to the species?

A: "Since you have asked multiple question, we will solve the first question for you. If you want any…

Q: PRACTICE PROBLEMS AND REVIEW QUESTIONS 1. What is the total magnification of an object if the ocular…

A: Magnification is the ability of microscope to produce an image of an object at a scale larger or…

Q: 3. Text Which of the below is not a way by which cells reduce signaling from trans membrane…

A: Signalling by Transmembrane receptor means recognition and binding of extracellular signal by an…

Q: on tail without carbon-carbon double bonds is saturated with respect to hy ment of proteins in a…

A: Membrane composition and arrangement can be defined by a fluid mosaic model which suggest that…

Q: 2. The endosperm of maize can either be yellow of White. with two alleles, Y has yellow endosperm…

A: INTRODUCTION The endosperm is the tissue that surrounds and nourishes the embryo in angiosperm seeds…

Q: bacteria

A: Auxotrophic strains lack the ability to synthesize one essential compound for example amino acid.…

Q: What complications might arise from genetic screens targeting an organ that differentiates late in…

A: The eye has been one of the most intensively studied organs in Drosophila. The wealth of knowledge…

Q: o identify: The four primary tissue types and give an xample of where those tissues are found in the…

A: Tissue is the cellular organisational level between cells and the entire organ in biology. Tissues…

Q: 21. Which of the following species, either presently or formerly listed as endangered or threatened,…

A: The endangered species are those plants and animals that have become rare as they are at risk for…

Q: Jesse is a cat from an old cartoon. The show was only produced in black and white, and Jesse now…

A: Given, ACC GCG GTT TAC TTT GCC CGA ATT GAT GA

Q: Figure 1.1 50 Passengers | Crew 40 • Half-day "Cruise cancelled 20 10 10 11 12 13 14 15 16 17 17* 18…

A: INTRODUCTION Salmonella Heidelberg (S. Heidelberg) is a bacterium that can cause severe illness in…

Q: Question - What is biology? A) The study of DNA. B) The study of the environment. C) The study of…

A: Question - What is biology?   A) The study of DNA. B) The study of the environment. C) The study of…

Q: SHORT ESSAY. Answer the following questions briefly. Write your answers on the space provided. Limit…

A: INTRODUCTION Thermoregulation This is the process by which mammals maintain their body temperature.

Q: Why is a strong reducing agent, such as NaBH4, not suitable for use in the conjugation of an…

A: The NaBH4 is a strong reducing agent and can reduce aldehyde, ketones and the acid chlorides into…

Q: Give the PLOIDY of the following (ex: haploid, diploid, etc…) 1. oospore 2. prothallus  3. androcyte…

A: Ploidy can be defined as a total number of sets of chromosomed present in a nucleus of a cell.…

Q: 1. How do animals reproduce? 2. How do humans reproduce? 3. How can the use of hydroponics help…

A: Reproduction is the process by which organisms make more organisms like themselves. But even though…

Q: For billions of years, the only bright objects in the night sky were stars or the moon. Night-flying…

A: Moths are nocturnal organisms. They are active during the night to escape from predators. They use…

Q: Air sae connection with humerus bone Branchus Humenus bone -Heart 7 Tsil

A: INTRODUCTION The respiratory device is one of the most important structures of the body. It has a…

Q: Can organisms in the class Cephalopoda successfully compete versus humans? Is there a possibility…

A: Class Cephalopoda comes under the phylum Mollusca. Organisms under class Cephalopoda are exclusively…

Q: Which gymnosperm family has genera that are not evergreen?

A: Introduction:- Gymnosperms (naked seeds) are four extant divisions of vascular plants with exposed…

Q: 6. In man, normal color vision vs red-green color blindness is controlled by the allelic gene C…

A: The colorblind trait is encoded by genes present on the X chromosome. It is a kind of recessive…

Q: discuss potential benefits as well as potential disadvantages of Eugenics for humanity.

A: Eugenics,also  called as human genetic engineering, changes or removes genes to prevent disease,…

Q: CLASSIFICATION EXAMPLES FEATURES Domain Archaea Kingdom Phylum Class Order Family Genus Species…

A: Classificiation can be defined as a arrangemant of taxa on the basis of certain observed…

Q: Consider the similarities and differences in the cell cycles (mitosis and meiosis) of plants and…

A: Mitosis and Meiosis similarity  1. Both occur during cell reproduction.  2. Both occur in stages.…

Q: translation

A:

Q: Poverty and hunger drive people to bear more children. a) True b) False 35 0

A: Not 100 % true but it true...

Q: What would be the working stock concentration (in molarity) if you diluted 250 uL of a stock…

A: Molarity is defined as the number of moles dissolves in 1000 ml of the solution.

Q: the adaptations that Plasmodium falciparum (Protists) has evolved to invade and manipulate the hosts…

A: Plasmodium is a protozoan parasite .this parasite is transmitted by Anopheles mosquitoes.

Q: (Y=black/y-yellow). The heterozygotes are the color mixture called calico or tortoise-shell. What…

A: The coat color is encoded by the genes present on the X chromosomes.  The black color is present in…

Q: For this statement, answer True or False and explain your answer briefly. A urine sample cannot be…

A: Introduction Forensic toxicology:- It is the application of toxicology to cases and issues where bad…