Q: Which gymnosperm family has genera that are not evergreen?
A: Introduction:- Gymnosperms (naked seeds) are four extant divisions of vascular plants with exposed…
Q: Define the term anthropometrics
A: The study of the human body and its movement, which frequently includes research into human…
Q: A maternal effect gene in Drosophila, called torso, is found as a recessive allele that prevents the…
A: Introduction The relationship between two variants of a gene is referred to as dominant. Each parent…
Q: With the understanding of DNA methylation and gene expression, answer these following questions with…
A: DISCLAIMER FOR MULTIPARTSince you have posted a question with multiple sub-parts, we will solve…
Q: VARIATION IN POPULATION DENSITY OF BEETLES 40 35 30- Species A Species B Species C 25 20- 15 10- 5…
A: Population density: Population density is actually the concentration or total number of a particular…
Q: What triggered the development and establishment of mi-crobiology as a science?(a) Spontaneous…
A: Microbiology is a branch of science that studies microscopic organisms that are not visible to the…
Q: Whereas _____ is the predominant immunoglobulin in intestinal fluid, _____ is the dominant…
A: Cell is a simple machine that houses all of the essential organelles required for life's sustenance.…
Q: 25. Modern agroecosystems differ from natural ecosystems in all of the following ways except: A.…
A: Answer
Q: Explain how Circulatory Systems works in a: Fish Prawn & Apple snail
A: Every cell, tissue, organ, and organ system in the body is fed by the circulatory system. The…
Q: Air sae comection with - humerus bone Humenus bone Branchus 4 Heart 6 7 8. Tail
A: As we know that like humans , animals are also composed of different cell types . Group of cells…
Q: lution. Please answer all question that is just one sentence each question. PART 2 1. Why is it…
A: Need to include the effects of natural selection: There is a boost for ecosystem productivity in…
Q: For this question please can I have sketch of a map of the pMBBS plasmid showing the relative…
A: Restriction enzymes are also called molecular scissors. These are generally employed in cutting the…
Q: Brefeldin A is a drug that disrupts the transfer of protein from the ER to the Golgi apparatus.…
A: Introduction :- The endoplasmic reticulum is the eukaryotic cell's transportation system, as well as…
Q: 1.Sustaining intense exercise requires ATP. Could a someone with a defective gene for the enzyme…
A: Metabolism is defined as the entire quantity of biochemical events that occur in an organism's cells…
Q: can you please explain the last part of step 2 further? Specifically this "The complementation…
A: Complementation is a relationship between mutations in an organism that helps us determine that the…
Q: _____ describes the situation when the immune response generated against an influenza strain limits…
A: Introduction An immune response is a process that takes place within an organism in order to…
Q: All of the following could be deduced from the table except CRITERIA MITOSIS MEIOSIS 1. No. of…
A: Introduction Mitosis and meiosis are the two kinds of cell division. When people say "cell…
Q: Label the organ systems of the cockroach found on the ventral and dorsal regions on Figures 9.1 and…
A: Cockroach It is an insect that belongs to the order Blattodea and to the superorder Dictyoptera. It…
Q: If an embryo splits at the two-cell stage, each of the resulting identical twins will have its own…
A: Identical twins: The splitting up of the embryos into two at the two-cell stage leads to the…
Q: While you were driving to San Francisco, you saw many billboards on the highway but you could not…
A: The smallest level of stimulation that may be recognised is known as an absolute threshold, which is…
Q: 3. You've discovered an exotic species of plant that can have three unusual autosomal recessive…
A: Linkage is defined as the inheritance of genes as a unit together in the offspring if they are…
Q: Your vaccine will be administered as a topical cream, and you require your peptide to have an…
A: pH is a measure of hydrogen ion concentration, a measure of the acidity or alkalinity of a solution.
Q: Question 5 Describe briefly the TWO distinct roles of the v-SNARE and t-SNARE proteins in vesicle…
A: Role of SNARE proteins in vesicle transport :-
Q: Jesse is a cat from an old cartoon. The show was only produced in black and white, and Jesse now…
A: Given, ACC GCG GTT TAC TTT GCC CGA ATT GAT GA
Q: What are the three phases of seed development? When does the peak of ABA concentration take place?…
A: Seed is part of tree from which whole plant is developed.Seed is obtained from the fruits. Seed…
Q: Your vaccine will be administered as a topical cream, and you require your peptide to have an…
A: A topical drug is one that is applied to a specific area of the body or to a specific organ. Topical…
Q: The O-antigen is part of the bacterium's which is found in the outer membrane of some bacterial cell…
A: Introduction Antigen:- These are any substance that causes the body to make an immune response…
Q: The biggest obstacle in the acceptance and development ofthe science of microbiology was the(a) Lack…
A: Introduction Microbiology is the scientific study of unicellular, multicellular, and acellular…
Q: Quarter Activity 4 Instructions Instructions Direction: Answer the following questions in paragraph…
A: 1) Body system: A collection of parts able to work together to serve a common purpose- growth,…
Q: Provide an illustration and describe the different types of egg as to the concentration of yolk they…
A: Isolecithal eggs : It is a type of holoblastic egg.. In this type yolk distribution is same that is…
Q: Homing and navigation in salmon (across developmental stages; e.g., from stream to ocean and back to…
A: Homing in migrating fishes, such as salmon, can be defined as a behavioral pattern in which an…
Q: Match the term in column A with its description in column B
A: The terms are correctly matched with the contents below
Q: How many pairs of chromosomes do human beings have, specify the types of chromosomcs also?
A: Chromosomes are fiber structures found in the nuclei of animal and plant cells. Nutrient and a…
Q: Another student places some of the bread from their sandwich near these objects and leaves them…
A: Introduction A cell or cells make up all living things. To exist, they must receive and use energy.…
Q: Which of the following correctly explains how gene expression can change in a differentiating cell…
A: Developmental biology describes how interacting mechanisms generate an organism's various size,…
Q: To determine: The trophic levels and the way in which they are related to ecological pyramids.
A: The Sun provides energy to the Earth in the form of light. The organisms efficiently exploit the…
Q: 2. Many animals preferentially assist individuals with whom they are most familiar. Explain how such…
A: Introduction Kin refers to someone you are related to a member of one's family.
Q: Distinguish among primary, secondary, tertiary, andquaternary levels of protein structure.
A: Proteins are the body's building blocks. It serves an important function in the body. Proteins are…
Q: For this statement, answer True or False and explain your answer briefly. In the precipitin test of…
A: Precipitin test is a simple serological technique that shows the precipitin reaction in solution.…
Q: How is viruses and protozoans can cause pathogenesis that is different from bacteria?
A: As we know that that the pathogen is disease causing organisms and can cause infection and…
Q: 4. Draw the actual map of the PMBBS plasmid, following the style of the sample map shown in Figure…
A: Restriction enzymes: Restriction enzymes are also called molecular scissors. These are named so…
Q: The development of DNA technology is bringing profound changes to science, agriculture and…
A: Introduction DNA technology is an extremely important research tool in biology as it allows the…
Q: Question - What is biology? A) The study of DNA. 3) The study of the environm C) The study of life.…
A: Science is the intellectual and practical activity encompassing the systematic study of the…
Q: Distinguish between catabolism and anabolism.
A: Metabolism refers to the chemical events that take place in the cell to produce energy. The acquired…
Q: Memory T cells _____. (Select all that apply.) a. must all be activated in secondary lymphoid…
A: Memory T cells are antigen-specific T cells that remain long-term after an infection has been…
Q: A series of two-point crosses were carried out among five loci (E, F, G, H, and I), producing the…
A: When two genes are near enough on the same chromosome, they are considered to be connected because…
Q: cells are part of an organ in the digestive system. Use evidence to explain how the intestinal cells…
A: Human digestive system chiefly consist of gastrointestinal tract and associated glands.The process…
Q: What is the name of the process by which bacteria pick up a different organism’s genetic material?
A: 4. A bacterium takes up a fragment of DNA circulating in its surroundings during transformation. A…
Q: What is the role of dendritic cells in the innate immune system?
A:
Q: A diabetic's blood sugar cannot be controlled because their pancreas can not produce enough insulin.…
A: Diabetes is a condition when the person cannot secrete enough insulin to regulate glucose levels in…
Describe in detail all of the steps necessary to carry out translation. You may write in complete sentences or provide a numbered or bulleted list. Be sure to indicate the role of each item below:
Amino acids, mRNA, 30S ribosome, 50S ribosome, tRNA, protein chain, E site, P site, and A site.
Step by step
Solved in 3 steps with 4 images
- Given the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also, write out the amino acid sequence of the protein encoded by this message. tRNA: UAC UCU CGA GGC mRNA: protein: How many hydrogen bonds would be present in the DNA segment?Methionine is used as the first amino acid for a particular polypeptide, but it is removed during the translation process in this case. After removal of the methionine, the final polypeptide is 246 amino acids in length. How many nucleotides were used to provide the genetic coding for this particular peptide chain? Explain your answer and be sure to account for the initiation and termination of the translation process.For translation, identify two things that happen during each step - initiation, elongation and termination.
- The template strand of a double helical segment of DNA consists of the following sequence: 5’-GTAGCCTTAAGCGATCACCGTCCGTATTACTAGTGGCCAGACTCTTTTCACTCTCATGTATAGTTG-3’ Following translation process, what is the amino acid sequence that will be coded for? (show your answer using ONE-letter amino acid code starting from N-terminus to C-terminus)An mRNA transcript is listed below and contains both start and termination codons. Assume that the initial methionine will stay on the polypeptide in this case. What amino acid sequence will be specified during translation? List the amino acids. The start codon is highlighted. 5’ – CAGCCAAGCAUGCUCGCAAAUGGACGUUGAUAUUUUGUC – 3’For each of the following sequences, rank them in order (from best to worst) as sequences that could be used to initiate translation according to Kozak’s rules. GACGCCAUGG GCCUCCAUGC GCCAUCAAGG GCCACCAUGG
- Which of the following best describes a sequence of events that happens during the elongation phase of translation? Group of answer choices A charged tRNA enters the P site of a ribosome; a tRNA bound to a peptide moves to the A site; an tRNA bound to a peptide exits the E site. None of these is an accurate description A charged tRNA enters the A site of a ribosome; a tRNA bound to a peptide moves to the P site; an uncharged tRNA exits the E site. An uncharged tRNA enters the A site of a ribosome; a tRNA bound to a peptide moves to the P site; a charged tRNA exits the E site. A charged tRNA enters the A site of a ribosome; a tRNA bound to a peptide moves to the E site; an tRNA bound to a peptide exits the A site.What is the order of the polypeptide chain shown in the images provided? Starting at the beginning of translation, determine the order of the amino acids in the polypeptide chain shown in this figure. Choose correct amino acids from the drop-down menu. (The choices from drop down menu are below). 1. (Choices): Leucine, Valine, Methionine 2. Leucine, Valine, Glycine 3. Valine, Methionine, Leucine 4. Methionine, Leucine, GlycineThe process of translation involves three distinct phases: initiation, elongation, and termination. Which of the following is an accurate statement of a molecular event that occurs during one of the phases? A. All phases of translation require the energy of ATP to fuel molecular processes. B. The first components to assemble in initiation are the large ribosomal subunit, mRNA, and the initiator tRNA molecule. C. A peptide bond forms between the new amino acid and the amino acid at the C-terminus of the growing polypeptide chain. D. Amino acids are added to the polypeptide chain that sits in the A site of the translation initiation complex.
- You have isolated a new organism from a sulfur hot springs in Yellowstone and are investigating its genetic code. You isolate the translation machinery from this organism and use it to translate (in a test tube) some RNA sequences that you have generated. In these systems, ribosomes, amino acids, and buffers that support translation are added and there is no control of where translation begins. Assume 3 bases = a codon. One of the mRNAs that you add to the test tube has this sequence: 5’ACUACUACUACUACU… 3’ (The dots indicate that the previous sequence repeats.) If the new organism uses the same genetic code as other organisms on Earth, what polypeptide(s) would you expect as a result in this experiment? a)Leu-Leu-Leu… and Tyr-Tyr-Tyr… b)Thr-Thr-Thr… c) Leu-Leu-Leu… and Ser-Ser-Ser… and Tyr-Tyr-Tyr… d)Thr-Leu-Tyr-Leu… e)Thr-Thr-Thr… and Leu-Leu-Leu… and Tyr-Tyr-Tyr…What are the specific steps of eukaryotic translation? Be sure in your discussion that you include the following terms: start codon, initiation, elongation, termination, tRNA, rRNA, A site, P site, E site, translocation; stop codon.Which of the following best describes the initiation of translation? A. The mRNA binds the large ribosomal subunit. The start codon is identified and an rRNA with methionine is bound to the start codon. B. The mRNA binds the small ribosomal subunit. The start codon is identified and the large subunit is recruited. C. The mRNA binds the small ribosomal subunit. The start codon is identified and a tRNA with methionine is bound to the start codon. D. The mRNA binds the small ribosomal subunit. The start codon is identified and the tRNA with methionine enters the A site.
