Figure 1 is a photography obtained after spreading the replicating Escherichia coli chromosomeand its observation by transmission electron microscopy. An interpretation scheme of theobserved structure is shown in the upper right part of the photo.Figure 1: Photography of a replicatingEscherichia coli chromosome observedDAby transmission electron microscopy.2to what do correspond respectively the grey, black and dotted lines?Indicate below the name of the chromosomal regions that are squared and namedrespectively A and B on Figure 1

Name: Figure 1 is a photography obtained after spreading the replicating Es
Uploaded: 2024-03-20T06:42:55.000Z
Channel: Bartleby
Description: Figure 1 is a photography obtained after spreading the replicating Escherichia coli chromosomeand its observation by transmission electron microscopy. An interpretation scheme of theobserved structure is shown in the upper right part of the photo.Fi

Replication is the process by which the single mother strand helps to produce two daughter strands.…

Answered: to what do correspond respectively the…

Science

Biology

to what do correspond respectively the grey, black and dotted lines? Indicate below the name of the chromosomal regions that are squared and named respectively A and B on Figure 1

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter6: Cytogenetics: Karyotypes And Chromosome Aberrations

Section: Chapter Questions

Problem 3QP: A colleague e-mails you saying that she has identified an interesting chromosome variation at 21q13....

See similar textbooks

Similar questions

For each of the terms in the left column, choose thebest matching phrase in the right column.a. reciprocal translocation 1. lacking one or morechromosomes or having oneor more extra chromosomesb. gynandromorph 2. movement of short DNAelementsc. pericentric 3. having more than two completesets of chromosomesd. paracentric 4. exact exchange of parts of twononhomologous chromosomese. euploids 5. excluding the centromeref. polyploidy 6. including the centromereg. transposition 7. having complete sets ofchromosomesh. aneuploids 8. mosaic combination of maleand female tissue
In an electrophoretic gel across which is applied a powerful electrical alternating pulsed field, the DNA of the haploid fungus Neurospora crassa (n = 7) moves slowly but eventually forms seven bands, which represent DNA fractions that are of different sizes and hence have moved at different speeds. These bands are presumed to be the seven chromosomes. How would you show which band corresponds to which chromosome?
The completely synthetic yeast chromosome Syn IIIcontains a loxP site in the 3′ UTR of every gene thatis potentially nonessential to yeast survival. As youwill recall from Chapter 6, loxP sites are targets ofsite-specific recombination. The researchers who constructed Syn III included these loxP sites as a way to“scramble” the chromosome, meaning that parts ofthe chromosome could easily be deleted or rearranged.The goal of these investigations is to drive the evolution of Syn III so as to define a minimal genome thatcan support the life of this organism. Outline the experiment the researchers would do to scramble Syn IIIin order to define a minimal genome.
. E. coli chromosomes in which every nitrogen atom is labeled (that is, every nitrogen atom is the heavy isotope15N instead of the normal isotope 14N) are allowed to replicate in an environment in which all the nitrogen is 14N.Using a solid line to represent a heavy polynucleotidechain and a dashed line for a light chain, sketch each ofthe following descriptions:a. The heavy parental chromosome and the productsof the first replication after transfer to a 14N medium,assuming that the chromosome is one DNA doublehelix and that replication is semiconservative.b. Repeat part a, but now assume that replication isconservative.c. If the daughter chromosomes from the first divisionin 14N are spun in a cesium chloride density gradientand a single band is obtained, which of the possibilitiesin parts a and b can be ruled out? Reconsider theMeselson and Stahl experiment: What does it prove?
Referring to Figure 17-19, draw a diagram showing theprocess whereby an inversion formed from crossing overcould generate a normal sequence.
. Genomes A, B, and C all have basic chromosomenumbers (x) of nine. These genomes were derivedoriginally from plant species that had diverged from each other sufficiently far back in the evolutionarypast that the chromosomes from one genome can nolonger pair with the chromosomes from any other genome. For plants with the following kinds of euploidchromosome complements, (i) state the number ofchromosomes in the organism; (ii) provide terms thatdescribe the individual’s genetic makeup as accurately as possible; (iii) state whether or not it is likelythat this plant will be fertile, and if so, give the number of chromosomes (n) in the gametes.a. AABBCb. BBBBc. CCCd. BBCCe. ABCf. AABBCC
If you are comparing the two telomeres in each entryin the following list, in which cases would you expectthe two telomeres always to have exactly the samenumber of TTAGGG repeats?a. One telomere at one end of a chromosome, one telomere at one end of a nonhomologous chromosome.b. One telomere at one end of a chromosome, onetelomere at the corresponding end of the homologous chromosome.
If you are comparing the two telomeres in each entryin the following list, in which cases would you expectthe two telomeres always to have exactly the samenumber of TTAGGG repeats?a. One telomere at one end of a chromosome, one telomere at one end of a nonhomologous chromosome.b. One telomere at one end of a chromosome, onetelomere at the corresponding end of the homologous chromosome.c. One telomere at one end of a chromosome, theother telomere at the other end of the samechromosome.d. One telomere at one end of a chromatid, the othertelomere at the corresponding position in the sisterchromatid.
If you expose human tissue culture cells (for example,HeLa cells) to 3H-thymidine just as they enter Sphase, then wash this material off the cells and letthem go through a second S phase before looking atthe chromosomes, how would you expect the 3H to bedistributed over a pair of homologous chromosomes?(Ignore the effect recombination could have on thisoutcome.) Would the radioactivity be in (a) one chromatid of one homolog, (b) both chromatids of one homolog, (c) one chromatid each of both homologs,(d) both chromatids of both homologs, or (e) someother pattern? Choose the correct answer and explainyour reasoning. (This problem extends the analysisbegun in Solved Problem III.)
Which chromosome does this gene CAGATTGTGAAGAGGTCTCTTGA, appear on in the human genome? Answerin numerical digits only.
The following gene arrangements in a particular chromosome are found in different geographic regions. The changes in sequence were due to sequential inversions. ABCDEF DECAFB DEFACB AFEDCB Assuming that the arrangement in “a” is the original arrangement, in what sequence did the various inversion types arise?
. For each of the terms in the left column, choose thebest matching phrase in the rigf. satellite DNA 6. small basic proteins that bind toDNA and form the core of thenucleosomeg. chromatin 7. complex of DNA and proteinswhere spindle fibers attach to achromosomeh. cohesin 8. beadlike structure consisting ofDNA wound around histoneproteinsi. histones 9. protein complex that protectstelomeres from degradation andend-to-end fusionsj. shelterin 10. regions of a chromosome thatare distinguished by stainingdifferencesht column.a. telomere 1. protein complex that keepssister chromatids togetheruntil anaphaseb. G bands 2. origin of replication in yeastc. kinetochore 3. repetitive DNA found near thecentromere in higher eukaryotesd. nucleosome 4. specialized structure at the endof a linear chromosomee. ARS 5. complexes of DNA, protein, andRNA in the eukaryotic nucleus