i need only correct answers, ASAP only correct answer, i will upvote 8. Codons are sequences that correspond to specific amino acids or signals during protein translation.Which sequence does NOT code for a stop codon?UGAO UAGUGGUAA9. Vacuoles are fluid-filled organelles present in some cells.Which function is NOT normally performed by vacuoles?Store enzymes that degrade biological moleculesStore pigments responsible for the different colors in plantsO Store salts, sugars, and waste productsStore DNA and other hereditary materials10. Genetics deals with the study of inheritance and variation of traits among organisms.What term is used to refer to inheritance where a single genecodes for more than one phenotype?Incomplete dominancePolymorphismCodominancePleiotropy 4. All chordate species are defined by the presence of a notochord.Which statement about the notochord is FALSE?The notochord secretes signaling molecules that aid in development.O The notochord is located ventrally to the spinal cord during embryonic development.The notochord serves as the axis of the early embryo.The notochord persists throughout the lives of all chordates.5. Autoimmune diseases occur when the host's immune system attacks healthy cells.Which autoimmune disease affects only a single organ?Diabetes melitus type 1Systemic lupus erythematosusRheumatoid arthritisMultiple sclerosis6. Which chromosomal disorder occurs as a result of having more or less chromosomes than the wild type?Jacobsen syndromeFragile X syndromeCharcot-Marie-Tooth diseaseKlinefelter syndrome7. Terrestrial organisms exchange gas with air instead of water.Which terrestrial organism uses lungs to respire?Land snailsO RoundwormsO SpidersO Insects

Since you have asked multiple questions, we will solve the first question for you. If you want any…

Answered: 8. Codons are sequences that correspond…

8. Codons are sequences that correspond to specific amino acids or signals during protein translation.Which sequence does NOT code for a stop codon? UGA O UAG O UGG O UAA

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter32: Deuterostomes: Vertebrates And Their Closest Relatives

Section: Chapter Questions

Problem 8TYK

See similar textbooks

Related questions

Q: 14. Now imagine that a mutation occurred in the g of the codon below and the G became a C. How would…

A: According to guidelines we have to answer the first question only. so please kindly post the…

Q: Translation is the flow of information from: a) DNAàDNA b) DNAà mRNA c) mRNAà polypeptide d)…

A: Introduction Genome consists of DNA/RNA which consists of nucleotides either deoxyribose…

Q: 4. Which mRNA sequence complements the DNA sequence below? (LS1-1)

A: DNA is a polynucleotide strand. DNA is transcribed into RNA and RNA is translated into proteins.…

Q: 2. What happens during translation? is read and Possible sentence frame: Translation is the process…

A: The protein synthesis occurs in cytoplasm by the process of translation.

Q: 8. Which serves as the template for the assembly of amino acids during protein synthesis? * A. DNA…

A: As per our guideline, I gave you the first 3 answer below. Please post rest of the question…

Q: 1. T DNA strand NUCLEUS MRNA CU CYTOPLASM 6. 5. Lysine 7. AAGUUU UGUUCA AA 4. 2.

A: CENTRAL DOGMA- Replication is the process when DNA replicates itself means it will make copies of…

Q: b) What is the MRNA sequence that would be created from the DNA template sequence above?…

A: Cell is the basic structural and functional unit of life. All the cells contains the nucleus with…

Q: 6 What is the complement of the mRNA triplet code in the tRNA? 7 In what way is tRNA different from…

A: RNA molecules are also called ribonucleic acids. RNA is composed of nucleotides attached with each…

Q: Which of these molecules is responsible for bringing the correct amino acid to the ribosome? acetyl…

A: Translation is the process by which the cells of the body prepare their own proteins in the…

Q: 9. Examine the image to the right, which represents a snapshot of translation. Which staan of…

A: Translation is the process of making proteins from RNA. Transcription is the process of making RNA…

Q: 1. Translation is the biological polymerization of amino acids into polypeptide chains from MRNA. 2.…

A: Hello. Since your question has multiple sub-parts, we will solve the first three sub-parts for you.…

Q: DNA C A T G C U MRNA U UG ERNA ionine Amino Acids is synthesized in translation or transcription?…

A: Transcription is the synthesis of m RNA from a DNA template. The translation is the synthesis of a…

Q: an amino acid has a codon that ends in a pyrimidine, which of the following is not necessarily true?…

A: One of the most important property of genetic code is the code is degenerate. This means that a…

Q: The strand of DNA contains the sequence of bases: CGA CCG TAC. What is the sequence of the…

Q: Considering each nucleotide sequence in an mRNA molecule: [1] write the sequence of the DNA template…

A: Gene expression is the process by which the instruction in the DNA is converted to products through…

Q: 5. A molecule with three bases on one end that can bind an amino acid on the other end during ge…

A: The central dogma is a vital process that is responsible for deducing the flow of genetic…

Q: 5. Now imagine that a mutation occurred in the g of the codon below and the G became a C. How would…

A: point mutation - change in single nucleotide sequence which alter the amino acid .

Q: 3. A mutation in a DNA sequence produced a new protein with an amino acid sequence that differs from…

Q: 3’ TACAATGGGCGACGCGCTTCGTTTCAGATT 5’ 5’ ATGTTACCCGCTGCGCGAAGCAAAGTCTAA 3’ Copy the template strand…

A: DNA sequence is given. Top strand acts as template for mRNA synthesis. Top strand sequence is 3’…

Q: 2: Translation Translation MRNA Codon Amino Acid GAA Glu ACG GAU UAC CAG CCC AUG GGC

A: Translation includes the decoding of the information in the mRNA (messenger RNA) into the functional…

Q: 8) Which of these describes the function of RNA polymerase? A. Amplifies the “message" by making…

A: Need to find which of the following is correct regarding RNA polymerase function.

Q: 1. What is called the functional unit of a DNA molecule that may code for RNA or protein? A. arnino…

A: DNA or deoxyribonucleic acid is the molecule that is made up of polynucleotide chains coiled around…

Q: 1: Transcription Transcription DNA nucleotides TAC АСА GAT TTT GTC ACT АТА MRNA codon AUG

A: The method of producing an RNA copy of a gene sequence is known as transcription. This duplicate,…

Q: Hello, my question is in the picture below. Thank you in advance!

A: Transcription is the process of converting DNA into m-RNA in the presence of enzyme RNA polymerase.…

Q: 1. In the DNA sequence, the bottom strand is a template strand. If the base pair G-C (in bold) is…

A: Transcription is a process which involves formation of RNA molecules from DNA. One of the DNA strand…

Q: emist 19.The last codon sequence in place on a strand of mRNA when a protein is being synthesized at…

A: The process by which mRNA is translated to the amino acid sequence is termed as translation. It…

Q: 7. Look at 6a and 6b. Compare the RNA sequences and the polypeptide sequences they code for. What…

A: A base pair is two nucleotides that together constitute a DNA ladder." A DNA nucleotide is composed…

Q: 2. An mRNA has a sequence AAAUUACUCGAAAUUGCGUGUAGUS'. DNA, t-RNA and amino acid sequence of the…

A: Introduction DNA is the hereditary material in humans and almost all other organisms. RNA is used to…

Q: Bēlöw is thế TEMPLATE strand of DNA for a particular gene. Template strand: 5' AATCАTAAСТСАТTG 3' A.…

A: The two types of strands in DNA are coding (non-template) and template (non-coding). Both strands…

Q: 5. What mutation(s) would eliminate peptide translation? Nonsense mutation

A: In the given case, the sequence of DNA is given. The RNA contains uracil in place of thymine. Thus…

Q: 2. Transcribe the following gene sequence to the appropriate MRNA codons: TCA TTT cCA CAG ACA * AGU…

A: Transcription is defined as the process of RNA formation from the template strand of DNA by the…

Q: 5. How does silent mutation affect protein production in the cell? Silent mutation A. changes the…

A: Introduction:- A mutation is a change in our DNA sequence that happens as a result of errors in DNA…

Q: 7. Explain how you would determine whether a single chain of nucleotides is RNA or DNA.

A: 7. In all living organisms, the material that contains the information which is transmitted from…

Q: 12) Which of the following processes occurs during transcription? A) DNA is replicated B) RNA is…

A: The information for the production of functional proteins are stored in segments of DNA called…

Q: What are the components of the initiation complex for translation

A: Translation is a process in which codon of mRNA code for specific amino acid. These amino acid…

Q: 2a. The DNA is mutated on the 4th base pair to the following: DNA:3'TAC GAT GAG GTC TGA ACT 5' 5 ATG…

A: Mutations are changes in the base pair that can effect the way proteins and mRNA is formed it can…

Q: 1. Why is specific.base pairing essential to the process of transcription and translation? How many…

A: INTRODUCTION There are total 64 codons that code for a total of 20 amino acids. Out of the 64…

Q: AAA CC GG G CA GG CCGU Phe Gly Arg

A: * Transcription is the process of copying DNA segment into RNA. *The DNA segments transcribed into…

Q: 1. Decoding mRNA into amino acids is called translation.

A: above given statements are about transcription, translation process and how amino acids makes a…

Q: 3. Write down the corresponding amino acids sequence for each mRNA sequence. Use the codon chart in…

A: Question 3 A) TAC CTA GCG CAC ATG TAG GTG GGC AAA GTT m-RNA sequence: AUG GAU CGC GUG UAC AUC CAC…

Q: 2. The sequence of a fragment of one strand of DNA is AATTGCATATACGGGAAATACGACCGG. Transcribe this…

A: DNA (deoxyribonucleic acid) is the hereditary unit of an organism. DNA is a double helical structure…

Q: 8. Consider the following strand of mRNA. a. What would the original template DNA have been? b. What…

A: The central dogma of molecular biology is the metabolic process by which the DNA was converted into…

Q: 8. DNA → TAC AGA CGG CAA CTC TGG GTG CTT TGT TCT CTT CTC AGT ATC MRNA → protein >

A: The Central Dogma in molecular biology is one of the most important concepts which throws light on…

Q: 3’ TACAATGGGCGACGCGCTTCGTTTCAGATT 5’ 5’ ATGTTACCCGCTGCGCGAAGCAAAGTCTAA 3’ Make vertical…

A: Codons are made of three nucleotides of DNA or RNA. Each codon codes for an amino acid. The amino…

Q: 4. A mutation changes a nonsense codon to an amino acid sequence. Write an example of such a…

A: Mutation is any change in the sequence of DNA that causes a change in the protein that is…

Q: 1. The following is the DNA sequence of a gene: 3' TACTAACTTAGCCTCGCATC 5' a. What amino acids are…

A: Non sense codons are stop codons which lead to termination of translation. These are - UAA, UAG,…

Question

i need only correct answers, ASAP

only correct answer, i will upvote

8. Codons are sequences that correspond to specific amino acids or signals during protein translation.Which sequence does NOT code for a stop codon?
UGA
O UAG
UGG
UAA
9. Vacuoles are fluid-filled organelles present in some cells.Which function is NOT normally performed by vacuoles?
Store enzymes that degrade biological molecules
Store pigments responsible for the different colors in plants
O Store salts, sugars, and waste products
Store DNA and other hereditary materials
10. Genetics deals with the study of inheritance and variation of traits among organisms.What term is used to refer to inheritance where a single gene
codes for more than one phenotype?
Incomplete dominance
Polymorphism
Codominance
Pleiotropy

4. All chordate species are defined by the presence of a notochord.Which statement about the notochord is FALSE?
The notochord secretes signaling molecules that aid in development.
O The notochord is located ventrally to the spinal cord during embryonic development.
The notochord serves as the axis of the early embryo.
The notochord persists throughout the lives of all chordates.
5. Autoimmune diseases occur when the host's immune system attacks healthy cells.Which autoimmune disease affects only a single organ?
Diabetes melitus type 1
Systemic lupus erythematosus
Rheumatoid arthritis
Multiple sclerosis
6. Which chromosomal disorder occurs as a result of having more or less chromosomes than the wild type?
Jacobsen syndrome
Fragile X syndrome
Charcot-Marie-Tooth disease
Klinefelter syndrome
7. Terrestrial organisms exchange gas with air instead of water.Which terrestrial organism uses lungs to respire?
Land snails
O Roundworms
O Spiders
O Insects

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step 3

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 3 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

1) Which statement about lungs and gas bladders is true? A) the first osteichthyans had lungs and these lungs were later converted to gas bladders in actinopterygians B) the first osteichthyans had gas bladders and these gas bladders were later converted to lungs in sarcopterygians C) after the two lineages branched apart, actinopterygians evolved gas bladder and sarcopterygians evolved lungs" 2) Why are sharks reliant on ram ventilation unable to breath while remaining in place like other fish do?
An open circulatory system (a) is characteristic of squids and other active mollusks (b) permits contracting muscles to recover quickly (c) has no blood vessels (d) is a unique characteristic of annelids (e) has hemolymph, which bathes tissues directly
What is the major morphological innovation seen in annelid worms? a. a complete digestive system b. image-forming eyes c. a respiratory system d. an open circulatory system e. body segmentation
1. Most members of the class__are terrestrial,although part of their lifecycle is tied to water. 2.Mammals are chordates that have __ which allow them to nurse their young with milk. Their bodies are covered with ___ and most of them give birth. 3.Many members of the class __ lay their eggs in pools, swapms or any other moist environment while continuing their life on land. 4.Cartilaginous fishes and bony fishes, belonging to the classes__ and ___ respectively,are chordates due to the presence of ___. choices: feathers hair amphibia Chondrichthyes Osteuchthyes Mammalia Chordata an endoskeleton an exoskeleton a backbone preen glands mammary glands
#11 Match the benefit to the correct chordate adaptation.: Match each number to the letter it matches with: A. allows organisms to walk on land B.allows organisms to lay eggs on land, without water C.allows organisms to generate their own heat D.provides a rigid structure for muscles ------------------------------------ 1.amniotic eggs 2.seeds 3.endotherm 4.tetrapod 5.ectotherm 6.bony skeleton 1.
1.Explain how crocodilian morphology makes it an ideal ambush hunter. 2.The Order Squamata consists of 3 sub orders.Why are these suborders so different-give at least 2 distinctive characteristics of each. 3.How do reptile eggs differ from amphibian eggs?why is it important?
Which of the following is associated with the evolution of the coelom? (a) radial symmetry (b) tube-within-a-tube body plan (c) incomplete metamorphosis (d) bilateral symmetry (e) development of ganglia
Which of the following is not a characteristic of all animals? (a) heterotrophic (b) multicellular (c) eukaryotic (d) presence of a coelom (e) formation of a zygote that undergoes cleavage
Reptiles are adapted to life on land by _____. a. waterproof skin b. internal fertilization c. efficient kidneys d. amniote eggs e. both a and c f. all of the above
Which of the following characteristics does not contribute to powered flight in birds? a. a lightweight skeleton b. efficient respiratory and circulatory systems c. enlarged forelimbs and a keeled sternum d. a high metabolic rate that releases energy from food rapidly e. scaly skin on the legs and feet
Which of the following is not contained in phylum Chordata? Cephalochordata Echinodermata Urochordata Vertebrata
1. Which of the following justifies the expansion of the allantois in shelled amniotes? * a. It stores excretory wastes of the embryo. b. It can be accommodated by the coelom. c. It forms allantoic vessels for gas exchange. d. It protects the embryo from mechanical stress.2. Which frog blastula region contains the materials for the presumptive notochord? * a. deep zone b. animal cap c. vegetal base d. involuting marginal zone 3. The process of activation during fertilization is triggered by which activity? * a. the binding of the sperm to ZP3. b. the binding of the sperm to ZP2. c. the binding of the sperm to PIP2. d. the opening of calcium channels.