Q: Compare the two mRNA sequences below. AUAUUCGGCAAUCCG AUAUUCCGCAAUCCG This change could be the…
A: Messenger RNA or mRNA is single stranded RNA which acts as template for the synthesis of amino acids…
Q: A) Draw the mRNA to be translated if the pre-mRNA is constitutively spliced. [ 3) Draw an mRNA to be…
A:
Q: If the DNA gene reads AAT GGT CCA CCG CTG, what will the MRNA read? O A. TTA CCA GGT GGC GAC O B.…
A: DNA is a macromolecule and is composed of nucleotides having sugar , phosphate and nitrogenous bases…
Q: In the diagram below, identify the mRNA by clicking on the correct highlighted portion. TACGGGCTA A…
A: Alleles are considered as the variant of the gene. DNA is composed of different nucleotides that…
Q: The mRNA sequence AUG CAC AGU codes for the first three amino acids of a particular protein. Which…
A: The mRNA synthesized after transcription process undergoes translation to synthesize proteins. The…
Q: If an mRNA codon reads UAC, its complementary anticodon will bea. TUC.b. ATG.c. AUG.d. CAG
A: During translation the ribosome traverses over the mRNA in order to produce a peptide chain with the…
Q: Why can’t the exact sequence of mRNA be determined from a protein’s primary structure? thanks
A: Primary structure of protein Primary structure of protein is comprise of linear amino acid sequence…
Q: de, translate the mRNA into an amino acid sequence.
A: Translation: It is the process by which sequence mRNA get translated into the sequence of amino acid…
Q: Explain why the statement is correct. A section of the mRNA has a nucleotide sequence of…
A: mRNA A single stranded RNA which is copied from DNA and contains gene or information about specific…
Q: If a strand of mRNA is UGC CAU GCC, what is the sequence of amino acids that will be produced? (use…
A: Proteins or polypeptides are the end products of the gene expression process. They are polymers made…
Q: Interpret this mRNA strand and determine the proper sequence and shape of this protein: AUG UCA CGC…
A: Introduction :- When transcription occurs, mRNA is produced. RNA polymerase decodes a single strand…
Q: Also answer Location number where correspond the 3 end of mRNA from this gene ans where u would find…
A: Exons are nucleic acid coding sequences that can be found in mRNA. Non-coding segments in DNA are…
Q: The dna is CAT CCA ACC ATA CCC CTA TAC CCA TAT CCT CCC ATT AAA CCG what is the mRNA and A.A.?
A: Thank you for the question Answer :- The process of conversion of DNA to mRNA is called as…
Q: In details summarize the process of Translation and post translation process.
A: Translation: Nucleotide language is transfer to language of amino acids. In short mRNA language is…
Q: Use the genetic code to complete the following table. Assume m that reading is from left to right…
A: In DNA double helix Adenine (A) pairs with Thymine(T) and Guanine (G) pairs with Cytosine (C).…
Q: Without using your textbook, determine what protein sequence would be translated from the mRNA…
A: DNA is the store house of genetic information. This information is in the form of nucleotide…
Q: Write the polypeptide sequence that would be translated from your mRNA sequence.
A: Answer - The DNA sequence will be - 5' CTATAAGGCGCAAATCCCTGCCAT 3' - Non-coding strand 3'…
Q: In which reading frame will this mRNA be read? 5'- ACAG C C U G CA A GU C A CU GACG- 3' O 1st O 2nd…
A: The order of amino acids in a protein from the N-terminus to the C-terminus is specified by mRNA…
Q: Name and explain the process by which mRNA is formed.
A: Gene expression is the process by which information which is contained in genes is decoded to…
Q: Three bases on MRNA that translate into an amino acid are called:
A: A translation is a process of conversion of mature mRNA molecules into long chains of a polypeptide…
Q: The first codon in a mRNA will be ____ and will code for ___ and the final codon will be ______ and…
A: To synthesize protein molecules, a cell must first transfer information from DNA to mRNA through the…
Q: In which reading frame will this mRNA be read? 5’- A C A G A U G C A A G U C U A A U G A C G - 3’…
A: Ans- b ) 2nd This mRNA will be read in the 2nd reading frame.
Q: The sequence A is read by RNA polymerase to produce an mRNA that is translated by the ribosome:…
A:
Q: Sequence of amino acids in protein
A: Protein Synthesis: It is the process of creating protein molecules. There are 5 major steps involved…
Q: If my final mRNA product sequence is this: CAAGAUGUACUUUGCGACAAGAGAGGAUCCCAUCUGUGCGACUUGAACG What…
A: The central dogma of life states that there is a unidirectional flow of information from master copy…
Q: Write a mRNA sequence for the below nucleotide sequences ATTACACACAGCGCGTATACGCGCGCGGGCTATA
A: The mRNA sequence is considered the template strand used to form the chain of amino acids. A codon…
Q: What will be the next amino acid added to the growing polypeptide chain?
A: mRNA contains codons and tRNA contains anticodon. Codons and anticodons are complementary to each…
Q: Provide the abbreviation for the amino acid sequence expected from the following MRNA segment using…
A: Following amino acid sequence is predicted.
Q: A. Below is a DNA sequence. Write the sequence of mRNA codons that would result from the…
A: According to the question, a DNA sequence is given. We have to find out the sequence of mRNA codons.…
Q: Write the amino acid sequence based on the following portion of MRNA. Write the name of the amino…
A: The codons which are present on mRNA are will code for specific amino acids based on genetic code…
Q: The tollowing mRNA transcript would result in which polypeptide sequence? 5'-ACU UUC ACU AUG UUU UUA…
A: Protein consists of amino acids linked by amide bonds or peptide bonds.
Q: The information in mRNA is in a tandem array of , each of which is…
A: m RNA or messenger RNA is formed by the instructions given in one of the two strands of DNA called…
Q: During transcription, a portion of mRNA is synthesized with the following base sequence.…
A: Introduction Gene expression can only occur when the Gene is transcribed into mRNA and then this…
Q: the space below, list the events that would occur during the processing of a primary RNA transcript…
A: In eukaryotes, however, the RNA transcript must undergo processing before it is a functional mRNA.
Q: List the four nucleotides found in mRNA.
A: Messenger RNA is a single stranded molecule made up of nucleotides. Each nucleotide is made up of a…
Q: Draw a eukaryotic mRNA that has been fully processed. Label the key parts including the Kozak…
A: The eukaryotic RNA is formed from the eukaryotic DNA by the process of transcription.
Q: Discuss the process of translation and how this differs from transcription
A: The process of protein synthesis from an mRNA template which is further converted into an amino acid…
Q: if the sequence of bases in the mRNA Codons is 5' - AUCCUACGU - 3' then the sequence of amino acids…
A: In the central dogma of molecular biology, DNA is converted into mRNA by the process of…
Q: If a DNA sequence , 3' TAC AAT GAA 5' , is the template for transcription, the resulting mRNA would…
A: CENTRAL DOGMA:- The whole process of Central Dogma involves two processes:- 1) When DNA changes into…
Q: Translation is the process by which the sets of 3 bases (codons) of the MRNA are read to specify the…
A: The translation is a process through which the mRNA gets translated into polypeptide chains. The…
Q: Using the genetic code below, decipher the following mRNA sequence.…
A:
Q: An mRNA has the following sequence: 5′–GGCGAUGGGCAAUAAACCGGGCCAGUAAGC–3′ Identify the start codon,…
A: The central dogma describes the flow of genetic information. It states that genetic information in…
Q: Identify the different regions of the mature mRNA by matching terms with regions. A В AUG UGA сар…
A: Mature mRNA or mature transcript is the RNA present in eukaryotes which consists of exons with all…
Q: When a triplet of bases in the coding sequence of DNA is “GCA,” the corresponding codon for the mRNA…
A: there are two types purines and pyramidines. A=T G=C In case of mRNA A=U Thymine is replaced by…
Q: If MRNA has the bases UAU, what is the matching tRNA? O UAU O ATA O TUT O AUA
A: DNA(deoxyribonucleic acid) is the genetic material in all organisms except few viruses. The genetic…
Q: If a sequence of mRNA is CUG AGU GCA, which of the following is the DNA segment from which it was…
A: DNA sequencing is defined as the way of determining the sequence of nucleic acid by identifying the…
Q: Given the mRNA for a protein: 5'–CCGAACGAUGGGCUAUCCCUAACCGUUU --- 3' Write the amino acid sequence…
A: DNA is the genetic material that gets transcribed into mRNA by an RNA polymerase enzyme. The…
Q: The DNA sequence of a gene is CCATGCT A. The corresponding mRNA produced from 6. this gene is a.…
A: The protein synthesis consumes large amount of a cell’s energy as compared to the other organic…
Trending now
This is a popular solution!
Step by step
Solved in 3 steps
- Transcribe an mRNA sequence from this TEMPLATE STRAND of DNA 3' CGTACGTGTATCCCATCC 5' 5' GCAUGCACAUAGGGUAGG 3' 5' GCAUGCACAUAGGGUAGG 3' 3' CGUACGUGUAUCCCAUCC 5' 5' GCATGCACATAGGGTAGG 3' 3' CGTACGUGTATCCCATCC 5'-Write down the complementary DNA sequence. TACCTAGCG CACATGTAGGTGGGCAAAGTT -Write down the complementary mRNA sequence for each of the following DNA sequence. A: TACCTAGCGCACATGTAGGTGGGCAAAGTT B: TAC ATG GTT ACA GTC TAT TAG ATG CTA TTT ACT TAG -If the first G changes to A what kind of mutation will happen? Show the change in amino acid sequence. This is base substitutions involve the replacement of one nucleotide with another. And it changes one amino acid coding, producing a missense mutation TAC CTA GCA CAC ATGTAGGTGGGCAAAGTT TAC CTA ACACACATGTAGGTGGGCAAAGTTHere is the nucleotide sequence of an imaginary strand of DNA: 5’ AATTGGCCATGC 3’. If this strand of DNA was transcribed, the resulting messenger mRNA molecule would be: Met-Val-Tyr-Lys 3’ TACGTACG 5’ 3’ TTAACCGGTACG 5’ 3’ UUAACCGGUACG 5’
- DNA: 3’ TACAGTCTGTAGCGTACATTATCGTGACCGACT 5’ From the given DNA sequence above, change one base in codon 8 to show same sense mutation.Rewrite the resulting DNA sequence below and encircle the base that you changed.DNA:mRNA:polypeptide chain:b. Identify the type of base pair substitution that you applied in codon 8 Add an A before codon 3 or delete the middle base in codon 3 to show the shift of reading frame to:a. the rightDNA:mRNA:polypeptide chain:b. the leftDNA:mRNA:polypeptide chain:Given this DNA strand: 3’ TACAGTCTGTAGCGTACATTATCGTGACCGACT 5’ Identify the following: mRNA: polypeptide chain:Here is a DNA template strand’s sequence and direction: 3’-TACGCGGTAATC-5’ . What is the sequence and direction of mRNA synthesized from this DNA?
- a) Replicate this sense strand to create a double-stranded DNA helix TGAGGATGAAACTCACACCGGGGCGCAGTTTGGCACTTAGATTCTTGTACACGACCTAGTATAACACAGTT b) Using this DNA double helix, express the gene – i.e. determine the resulting polypeptide sequence by using the correct reading frame. When you get to the stop codon – you may write an asterisk (i.e. a “*”) to denote the stop codon. c) Does the sense strand DNA sequence have 5’ and 3’ UTR sequences? If so – write them in the space below 5’ UTR: 3’ UTR:5' ACTGAGGATTCGGACAGCAATAGGATG 3' The -2 reading frame of the sequence above gives the following amino acid sequence: ILLLSESS Which DNA codon represents I (isoleucine)? a) 5' TCC 3' b) 5' TAG 3' c) 5' ATC 3' d) 5' CCT 3'Coding DNA 5’- GTG ACT CGT TGT GCC ATT GCA GCT AAA CAC TTC GAG CCC TGT- 3’ mRNA 5’- GUG ACU CGU UGU GCC AUU GCA GCU AAA CAC UUC GAG CCC UGU- 3’ What is the polypeptide sequence?
- A strand of DNA contains this nucleotide sequence: TACTGCCTCCCCATAAGAATT. The corresponding nucleotide sequence of the mRNA strand from this DNA template is as follows: AUGACGGAGGGGUAUUCUUAA. Q: What is the amino acid sequence of the polypeptide that is produced form the mRNA strand? As well, draw a labelled diagram of the mRNA molecule being transcribed from this strand of DNA.Transcribe and translate the following DNA sequence (nontemplate strand); 5GCATGCGCGGCCATGTTGATTAAGCA 3Show and label the ends of your code for each step.1. what will be the mRNA complimentary strand of a DNA sequence AATCGGCTGGGATTA? a. UUAGCCGACCCUAAU b. AAUCGGCUGGGAUUA c. TTAGCCGACCCTAAT d. UUTCGGCTGGGUTTU 2. what will be the amino acid sequence of DNA with a sequence AATCGGCTGGGATTA? a. leucine - alanine - aspartic acid - serine - aspagarine b. leucine - threonine - aspartic acid - serine - aspagarine c. leucine - alanine - aspartic acid - proline - aspagarine d. tyrosine - alanine - aspartic acid - proline - aspartic acid 3. what type of points mutation happened if the mutated DNA sequence is TTA-CAG-CAG-GGT-GGC? a. addition b. deletion c. insertion d. subtitution 4. if the first nitrogenous base "T" will be replaced by "G" ; what will be the resulting amino acid for the first codon? a. isoleucine b. leucine c. tyrosine d. trytophan 5. what type of point mutation happened if the mutated DNA sequence is TTS-CGC-AGG-GTG-GC? a. addition b. deletion c. insertion d. substitution