Use the diagram below and match the correct options from drop-down menu on the right. P-site TRNA 505 GDP Peptide C mRNA The diagram depicts the translation Protein factor 1 is Protein factor 2 is Protein factor 3 is Protein Factor 4 is stage of 3 EF G [Choose ] [Choose] RF-3 IF2-GTP Elongation RRF EF-Tu_GTP Termination Initiation RF1/2 IF-1 Initiation and Elongation IF-3 [Choose] GTP GTP hydrolysis ܝܤܘܬ

Use the diagram below and match the correct options from drop-down menu on the right. P-site TRNA 505 GDP Peptide C mRNA The diagram depicts the translation Protein factor 1 is Protein factor 2 is Protein factor 3 is Protein Factor 4 is stage of 3 EF G [Choose ] [Choose] RF-3 IF2-GTP Elongation RRF EF-Tu_GTP Termination Initiation RF1/2 IF-1 Initiation and Elongation IF-3 [Choose] GTP GTP hydrolysis ܝܤܘܬ

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter28: Dna Metabolism: Replication, Recombination, And Repair

Section: Chapter Questions

Problem 21P

See similar textbooks

Similar questions

Define the following terms:a. cotranslational transferb. posttranslational transferc. TOM receptor proteind. TIM complexe. mthsp70
Define the following terms:a. decoding centerb. peptidyl transferase centerc. GTPase-associated centerd. guanine nucleotide exchange factore. proton shuttle mechanism
Give typing answer with explanation and conclusion The following gene codes for a liver enzyme. Changing the A/T base pair to which of the following would result in a missense mutation? 5’ GCCTAATATGCCCGTATGC(AGC)nCGAATAAAATAGTACGGTCGTCGC 3’ 3’ CGGATTATACGGGCATACG(TCG)nGCTTATTTT ATCATGCCAGCAGCG5’ A. C/G B. T/A C. G/C D. Any of the above E. 2 of the above F. None of the above
Which factor has NOT been shown to play a role in determining the specificity of protein kinases? a. protein tertiary structure b. protein quaternary structure c. primary sequence at phosphorylation site d. disulfide bonds near the phosphorylation site e. residues near the phosphorylation site
Proteasome inhibition might lead to an immediate ________ Select one: a. increase in cysteines b. increase in amino acids c. decrease in protein abundance d. increase in protein abundance e. increase in cofactors
The text states that ATP is synthesized primarily by energy metabolism,whereas other nucleoside triphosphates are formed from the action of nucleoside diphosphate kinase. What additional pathway exists for GTP synthesis?
Create a metabolism cocept map using these terms RepressorInducer RiboswitchRepression InductionPositive regulationActivatorOperator Heat shocklac operontrp operon Catabolite RepressionHeat shocksigma-32 Negative regulationTwo-component regulationSensor Kinase Autoinducing Peptide (AIP)Response regulatorSigma factorsFeedback inhibitionProtein StabilityQuorum SensingRNA regulationAntisense RNAHomoserine Lactone (AHL)
Overall RNA metabolism and proteins involved are regulated by ubiquitin signaling. Explain how ubiquitination plays role in maintaining certain levels of proteins needed by including the process of protein degradation, ubiquitination, any enzymes, proteasome, any ATP hydrolysis. PLEASE do not provide me with a super long answer. Short and to the point would be greatly appreciated!!!!!
Some transcription factors contain bromodomains. Explain the function of the bromodomain? Please help expalin this in 5 sentences or less, thank you!
If the following truncated peptide represents the active domain of the COVID19’s S-protein N-terminal ----Leu-Leu-Gly-Cys-Ile-Glu-Ser-Thr-Cys-Ala ------ C-terminal a) state the RNA sequence of this peptide given that Leu is the first amino acid b) show a point mutation using the RNA sequence & explain how it results in silent mutation effect c) show a deletion mutation using the RNA sequence & explain the consequence(s)
Which statements decribe the function of the protein encoded by this gene CAGATTGTGAAGAGGTCTCTTGA? A. Break point cluster region protein that may function as a GTPase B. A coagulation factor C. An enzyme involved in the breakdown of glycosaminoglycans (GAGs) D. Transcription factor involved in the DNA damage response E. A component of hemoglobin F. A tyrosine kinase G. Serine/threonine kinase involved in the DNA damage response H. A tumor suppressor involved in WNT signalling I. A DNA repair enzyme involved in nucleotide excision repair
Which of the following would be a good chemotherapy approach: blocking formationof the ribonucleotide GTP or blocking formation of the deoxyribonucleotide dGTP?Why? Please explain the chemical differences between each of the two nucleotides. Use the specific processes below to support your choice by explaining how either GTP or dGTPare related to these and how loss of the particular molecule would affect each process. *PEP carboxykinase in gluconeogenesis*Succinyl-CoA synthetase in the TCA Cycle*Glucagon signal transduction