Using ClustalOmega (available here), compare the nucleotide sequence of the regulatory region for each of the reporter gene variants to the wildtype. Ensure that you keep the “>Ara..." header for each sequence as this tells the software where one sequence ends and another begins. You can simply copy and paste the nucleotide sequences provided on Moodle (including the headers) into the submission box on the Clustal website, make sure that each time you include the wildtype sequence for comparison, ensure that you select DNA from the dropdown box. For each ClustalOmega alignment, ensure that you compare the wildtype sequence with at least ONE of the mutant sequences. b) Based on your in silico analysis (as described in the accompanying video) of each of the reporter constructs, describe how the phenotype displayed in the lab might be explained through a mutation. Ensure that you justify your response by stating how the mutations would result in a change in the transcription of the reporter gene.

Using ClustalOmega (available here), compare the nucleotide sequence of the regulatory region for each of the reporter gene variants to the wildtype. Ensure that you keep the “>Ara..." header for each sequence as this tells the software where one sequence ends and another begins. You can simply copy and paste the nucleotide sequences provided on Moodle (including the headers) into the submission box on the Clustal website, make sure that each time you include the wildtype sequence for comparison, ensure that you select DNA from the dropdown box. For each ClustalOmega alignment, ensure that you compare the wildtype sequence with at least ONE of the mutant sequences. b) Based on your in silico analysis (as described in the accompanying video) of each of the reporter constructs, describe how the phenotype displayed in the lab might be explained through a mutation. Ensure that you justify your response by stating how the mutations would result in a change in the transcription of the reporter gene.

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter13: An Introduction To Genetic Technology

Section: Chapter Questions

Problem 20QP: Analyzing Cloned Sequences A base change (A to T) is the mutational event that created the mutant...

See similar textbooks

Similar questions

Describe the difference between a transcriptional fusion and a translational reporter gene fusion. What sequences should you include in each? What types of information can be garnered from their analyses? Please include annotated pictures of the reporter gene expression patterns.
Describe the process of cloning a DNA fragment into theBamHI and PstI sites of the vector pUC18. How would youscreen for clones that contain an insert? and explain the process(steps) by drawing
What would be the consequence of inserting 10 random base pairs immediately downstream of the -10 box in a strong promoter? And What sort of lab techniques/experiments could be used to determine these consequences?
You design a guide RNA to target your gene of interest, which you will express attached to a scaffold RNA. You transform cells with Cas9, the guide+scaffold RNA, and an HDR template. The HDR template codes for the insertion of a premature stop codon located 10 bp upstream of the Cas9 cut site, a base pair substitution 15 bp upstream of the Cas9 cut site, and a base pair substitution in the PAM sequence. Question: Is this scenario “possible” or “not possible”? Cas9 cuts the target site, the stop codon and the two base pair substitutions are introduced.
E. coli strain BW25113 can grow on (D) Arg as the sole carbon source. A scientist working with you on this project has discovered that mice encode a protease that cancleave between (D)Arg‐(D)Arg. a. In a set of discrete steps outline how to construct this genomic library so that recombinant expression can be performed in E. coli b. Once the genomic library has been constructed, describe in DISCRETE steps how you would isolate the DNA sequence that encodes for the protease that cleaves between (D)Ag-(D)Arg
Shown below is a portion of a wild-type DNA sequence that encodes the last amino acids of a protein that is 270 amino acids long. The first three bolded base pairs indicate the frame and include the coding region. 5^ ...GCTAAGTATTGCTCAAGATTAGGATGATAAATAACTGG 3^ 3^.. CGATTCATAACGAGTTCTAATCCTACTATTTATTGACC 5^ Which strand is the template strand for transcription of this gene? Briefly explain how you know. An insertion of one base pair causes the protein to decrease in length by seven amino acids. With respect to the sequence given above, where does this insertion occur? A change of one base pair leads to the protein increasing in the length by one amino acid. With respect to the sequence given above, which base pair would you change, and what would you change this base pair for the protein to increase in the length by one amino acid?
Analyzing Cloned Sequences A base change (A to T) is the mutational event that created the mutant sickle cell anemia allele of beta globin. This mutation destroys an MstII restriction site normally present in the beta globin gene. This difference between the normal allele and the mutant allele can be detected with Southern blotting. Using a labeled beta globin gene as a probe, what differences would you expect to see for a Southern blot of the normal beta globin gene and the mutant sickle cell gene?
If the 5’ splice site sequences changed from 5’GUAAGU 3’ to 5’ GUAUGU 3’, predict the effect of the sequence on U1 binding and u6 snRNP binding in an invitro protein binding assay.
You ran the agarose gel but forgot to include the lactose-induced 23S reaction (template - cDNA). Without repeating the gel, what conclusions could you make about gst::egfp mRNA levels after lactose and IPTG induction? What would remain inconclusive? What if the sample you forgot to include was the negative control of lactose-induced 23S reaction (template - RNA)?
Researchers are manipulating the gene cxx2 for their experiments, and they have inserted a smallnumber of base pairs randomly somewhere into the gene. They isolate several versions (with differentinsertions) of this modified gene and carry out an RT-PCR using a primer that recognizes thetranscriptional start site area (eg. from +1 to +20), and a primer that binds to the polyA tail.For the second modified gene sample, they observe that the mature mRNA is now several basepairs longer, however splicing has not been affected. They examine the protein and identify thatit has significant changes to its amino acid sequence, altering its length. Which of the letteredarrowheads indicates the location where this insertion could be? (There could be one answer orseveral. Give all answers that apply)
When a region of DNA that contains the genetic information for a protein is isolated from a bacterial cell and inserted into a eukaryotic cell in a proper position between a promoter and a terminator, the resulting cell usually produces the correct protein. But when the experiment is done in the reverse direction (eukaryotic DNA into a bacterial cell), the correct protein is often not produced. Can you suggest an explanation?
The sequence at one end of one strand of the Drosophilatransposon Mariner is shown below (dots indicatesequences within the transposon):5′ TTAGTTTGGCAAATATCTCCCTTCCGCCTTTTTGATCTTATGT... 3′You obtain a mutant bacterial strain tagged with anengineered Mariner transposon, cut the genomicDNA from this strain with the restriction enzymeMboI (whose recognition site is ^GATC), and circularize the resultant DNA fragments by diluting therestriction enzyme digest and adding DNA ligase.a. Design two 17 bp PCR primers that you could useto identify (by inverse PCR) the gene into whichthe transposon inserted.b. What DNA sequence will be amplified from thecircularized fragments of the mutant genome?Show the extent of this DNA sequence on a mapof the genome of the mutant strain, indicating thelocations of the transposon insertion and any relevant sites for the enzyme MboI.