Assume the first nucleotide in the sequence is at the +1 position. Transcribe the DNA sequence into mRNA and then translate it into the polypeptide. Give the polypeptide sequence in the following form: Met-Thr-Trp-Tyr-Val etc.  5' ACCGAAGGACTTATGGAGCGCTCATGATTTGCT 3'

Q: Translate the following mRNA nucleotide sequence into an amino acid sequence, starting at the first…

A: The deoxyribonucleic acid (DNA) is the hereditary material that transmits the genetic information…

Q: What MRNA sequence codes the tripeptide shown below (write code in direction of N-terminus to…

A: Peptides are present in all individuals which are living. Peptides play may functional roles in our…

Q: For the following mRNA sequence (reading from left to right) what will be the amino acid sequence…

A: Genetic code consists of four letters 'GACU' which stands for guanine, adenine, cytosine, and uracil…

Q: Refer to Figure 9.7, then translate the following mRNA nucleotide sequence into an amino acid…

A: Ribonucleic‌ ‌acid‌ ‌(RNA)‌ ‌‌also‌ ‌contains‌ ‌genetic‌ ‌material‌ ‌but‌ ‌rarely‌ ‌takes‌ ‌part‌…

Q: Using the genetic code, indicate which polypeptides would be synthesized if poly-UGG were used in a…

A: Polypeptides are amino acid chains that forms the various protein molecues in our body. These…

Q: TRANSLATE this RNA sequence: AUGCAAUGA Met-Gin-Stop Met-His-Stop Thr-Glu-Stop Thr-Pro-Stop What…

A: As you have posted multiple questions, we are supposed to answer only first 3 subparts. Kindly…

Q: Consider this list (below) of steps involved in translation. These steps are out of order.…

A: Translation is the process by which ribosomes in the cytoplasm or endoplasmic reticulum generate…

Q: what percentage of the total amino acids in the protein would be made up of proline (Pro)?

A: Proline is an amino acid codded by the codons CCG, CCC, CCU, and CCA. Any one of these codons can…

Q: TACTGCCTCCCCATAAGAATT

A: Transcription is the process in which a gene's DNA sequence is copied (transcribed) to make an RNA…

Q: describe, using diagrams etc., how information stored in the DNA is translated into a peptide. Be…

A: Usually Central dogma of Molecular Biology is followed during the process of protein synthesis which…

Q: Translate the following mRNA nucleotide sequence into an amino acid sequence, starting at the second…

A: The mRNA (messenger ribonucleic acid) is synthesized from a DNA (deoxyribonucleic acid) template.…

Q: Which of the following is the MRNA coding for the peptide trp-met-gly- ser-his? A.…

A: The genetic codes are the sequence of nucleotide that governs the formation of proteins.

Q: (a) Write the sequence of the mRNA molecule synthesized from a DNA template strand having the…

A: Proteins are the biological polymers of amino acids. They are formed by peptide bonds by polypeptide…

Q: Without using your textbook, determine what protein sequence would be translated from the mRNA…

A: DNA is the store house of genetic information. This information is in the form of nucleotide…

Q: Using the table above and the mRNA transcript AUG-CUC-UAC-AAG-UAG, choose the false statement: XXX…

A: Nucleic acids are involved in various processes in the cell, their main role is the expression of…

Q: An mRNA has the following sequence: 5' ACCAUGUACUGUCCUGCUGUUUGA 3'. Beginning from the start codon,…

A: In Amazon instant there are four type of nucleotide bases i.e adenine, guanine, cytosine and uracil.…

Q: If a DNA sequence is 5’ CGCTAGACT 3’, the complementary DNA sequence will be? If a DNA sequence is…

A: DNA (deoxyribonucleic acid) was discovered by Friedrich Miescher. Nucleotides are the structural…

Q: Below is a polinucleotide sequence of the non-template strand of a coding DNA sequence. Use the info…

A: Central dogma of molecular biology:   It states that the DNA which contains the genes are…

Q: Below is a diagram of charged tRNAs in the active site of the ribosome during translation of the…

A: Translation is the process of synthesis of protein. It takes place in the cytoplasm.

Q: Which is the DNA template given if the MRNA is 3- CGGAUGCCCGUAUAC -5 ? O 3- GCCTACGGGCATATG-5 O 5-…

A: The common rule of Base pairing in DNA is: A pairs with T by a double bond and G pairs with C by a…

Q: Which of the following statements regarding the genetic code is false? The genetic code is…

A: Genetic code is used for ways in which the four bases of DNA- - the A, C, G, and Ts- - are hung…

Q: For the messenger RNA sequence below, find the beginning of the amino acid coding sequence and…

A: Translation is a technique which refers to the process of translating mRNA sequence into amino acid…

Q: The following sequence is the coding strand of a piece of DNA. Type out the corresponding template…

A: The protein sequence can be decoded by a coding or template DNA given. The mRNA strand is the same…

Q: Transcribe the following DNA strand into mRNA and translate that strand into a polypeptide chain,…

A: Transcription is the process by which RNA is synthesized from DNA. The genetic material is…

Q: Write down the complementary mRNA sequence for each of the following DNA sequence. A:…

A: If template sequence of the DNA is A..   mRNA is .. AUGGAUCGCGUGUACAUCCACCCGUUUCAA

Q: Transcribe the following DNA sequence.  Then translate the resulting mRNA transcript.…

A: Mutation is any change in the DNA sequence. It can alter the protein sequence because the proteins…

Q: Illustrate the process of translation by providing the correct bases for tRNA strand given the mRNA…

A:

Q: The MRNA produced when the following sense strand DNA sequence is transcribed is: 5'-…

A: The transcription unit is the segment of DNA that takes part in transcription. It is studied under…

Q: Which of the following mRNA codons could be changed to a stop codon by a single base pair…

A: A codon consists of three-nucleotides (A, G, C, or U) of RNA and carries the genetic information.…

Q: The following segment of DNA codes a protein. The uppercase letters represent exons, the lowercase…

A: Introduction Translation is the process by which ribosomes in the cytoplasm or endoplasmic reticulum…

Q: Transcribe the DNA strand given above to write the sequence of the mRNA strand in the 5’ to 3’…

A: According to Bartleby guidelines, we are required to attempt first three sub-parts in case of…

Q: An mRNA transcript is listed below and contains both start and termination codons. Assume that the…

A: mRNA(messenger RNA) is a type of RNA(ribonucleic acid) that carries complementary sequence…

Q: Using a codon table, complete the DNA triplets, mRNA codons, tRNA anticodons, and amino acids in the…

A: Genetic code is in triplets and the codes are read by the anticodon and thus the amino acids are…

Q: If a TRNA anticodon was GUG, which amino acid would the tRNA carry? Below is a partial genetic code…

A: TRANSLATION It is the process of formation of a polypeptide chain by joining of various amino acids.…

Q: Which of the following is TRUE in translation? A. Amino acyl TRNA containing one amino acid is…

A: The translation is the process by which amino acids chain or polypeptide chain is produced from the…

Q: An RNA polymer is made by using the enzyme polynucleotide phosphorylase with equal quantities of CTP…

A: The amino acids are coded by the group of three bases called base triplets and codons.

Q: What amino acid sequence will be generated, based on the following DNA codon sequence? Did you read…

A:

Q: UAG CUA UCA AAU AGA, what tRNA anticodons would be needed to translate the sequence?

A: RNA- It  stand for the ribonucleic acid.  is a nucleic acid present in all living cells and in some…

Q: The template strand of a double helical segment of DNA consists of the following sequence:…

A: Translation is the mechanism by which ribosomes in the cytoplasm or endoplasmic reticulum…

Q: The following segment of DNA codes a protein. The uppercase letters represent Exons, the lowercase…

A: DNA and RNA are the biomolecules that make up the part of our genetic material. DNA is the genetic…

Q: Here is an mRNA sequence (written 5' → 3') A G G G A G G U A A C A G 14 15 16 17 18 19 20 21 24 27…

A: The translation initiation codon is the 5'-AUG-3'. From this codon the first amino acid is…

Q: Analyze the following amino acid sequence and write down a potential mRNA sequence from which this…

A: The translation is a process by which ribosomes in the endoplasmic reticulum synthesize proteins…

Q: Use the genetic code table. Which amino acid is coded for by only one codon sequence? Second…

A: Ans is.. methionine

Q: A tRNA's anticodon binds to the RNA sequence: 5'-CUA-3'. What is the sequence of the tRNA's…

A: RNA is Ribonucleic acid which is formed from DNA via the process of transcription . It takes place…

Q: A small section of bacterial mRNA has the following nucleotide sequence: GAC CCG AUG AAC The tRNA…

A: Translation  It is the synthesis of proteins from the codons present in the mRNA. Anticodons…

Q: If the sequence of an mRNA is GAGUUCACAGUAGGC, the sequence of the template strand of the…

A: DNA strand – DNA is a Deoxyribonucleic acid. It is made up of two polynucleotide chains which are…

Q: transcribe the following DNA strand into mRNA and translate that strand into a polypeptide chain,…

A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…

Q: Indicate the amino acid sequence of the protein encoded by the following mRNA molecule.  Use the…

A: Transcription is the process in which the synthesis of RNA takes place by using deoxyribonucleic…

Q: The following sequence is from the template strand of a bacterial gene, and it includes the…

A: According to the central dogma of the molecular theory, the information stored in DNA is first…

Q: A particular triplet of bases in the anticodon strand of the tRNA is 5' - AGU - 3'. A.  The…

A: The single-stranded RNA is called messenger RNA.  The ribosomes read an mRNA when making proteins.…