When researchers obtain genomic sequence data from organisms with little known genetic information, they often search for open reading frames (ORFS) to classify potential genes. Suppose scientists have collected the sequence 5'-TAATGCCTAGTACCGGACTGAGTCAGTGTCTA–3' 3'-ATTACGGATCATGGCCTGACTCAGTCACAGAT–5' Select the reading frame that corresponds to each translational product. You may want to use the Codons table and the Amino Acid Abbreviations table. Stop codons are noted as a dash (–). MPSTGLSQCL NA-YRTESVS -TLTQSGTRH -CLVPD–VSV
Q: It is known that the second amino acid in that protein is argınine, and if we zoom in and look in…
A: The coding strand is the sense strand of the DNA double helix that has the polarity of 5'--> 3'…
Q: Here is a eukaryotic gene. The numbers given are base pairs of exon and intron. How long in bases…
A: In eukaryotic organisms, the gene contains introns as well as exons. Eukaryotic genomes are much…
Q: Which of the following set(s) of primers a-d could you use to amplify the following target DNA…
A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…
Q: The DNA sequence of a short gene from a sea slug, and the mature RNA synthesized from this gene, are…
A: The transcription is intended to generate an RNA copy of the DNA sequence for the gene. The RNA…
Q: Here is the sequence of a portion of a bacterial gene. The template strand is on the bottom:…
A: Deoxyribonucleic acid (DNA) is a double-stranded, a self-replicating material that is present in…
Q: Here is the sequence of a portion of a bacterial gene. The template strand is on the bottom: 5’-…
A: DNA and RNA are are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid…
Q: Some DNA nucleotides are located within the coding regions of genes, where they specify the amino…
A: When transcription activator proteins bind to the regulatory promoter sequences of gene, they…
Q: Phenylalanine (Phe) is encoded by either UUU or UUC, while Tyrosine (Tyr) is encoded only by UAC and…
A: Given Phenylalanine (Phe) is encoded by either UUU or UUC, while Tyrosine (Tyr) is encoded only by…
Q: The b1 allele encodes a transcription factor that stimulates production of anthocyanin, a purple…
A: It is given that seven tandem repeats were deleted that are located 100,000 bp upstream of the b1…
Q: . The human gene for ß2 lens crystallin has the components listed below. The numbers represent…
A: Since we only answer up to 3 sub-parts, we’ll answer the first three. Please resubmit the question…
Q: The DNA sequence of a short gene from a sea slug, and the mature RNA synthesized from this gene, are…
A: The transcription is the process in which the mRNA copied information from DNA for protein…
Q: The Dscam locus in Drosophila melanogaster has 24 exons. Four of these exons are able to undergo…
A: Alternative splicing results in several products being made from one chromosome. In higher…
Q: Draw a typical eukaryotic gene and the pre-mRNA and mRNA derived from it. Assume that the gene…
A: Introduction A genome is consists of transcriptionally active genes. These genes form mRNA as they…
Q: Which of the following mRNA sequences codes for the polypeptide sequence tyrosine-leucine-alanine?…
A: Transcription is the process that synthesizes mRNA from DNA. The mRNA strand synthesized through…
Q: he question with gene sequence to predict amino acid sequence.
A: introduction Translation is the process of translating the sequence of a messenger RNA (mRNA)…
Q: GIVEN THE FOLLOWING DNA SEQUENCES (+) OF THE GENBANK: INDICATE WHICH IS THE TEMPLATE MOLECULE, WHICH…
A: The template strand extends from 3' to 5'. The coding strand, that extends from 5' to 3' in…
Q: Geneticists have found that when they cut out a eukaryotic gene from genomic DNA that they can…
A: Splicing The removal of introns (non coding part of gene) from pre mature RNA.
Q: The length of a particular gene in human DNA, measured from the start site for transcription to the…
A: Transcription is a process of formation of transcript or RNA from DNA by the process of…
Q: Know the name of the RNA molecule that is the initial product of the transcription of a eukaryotic…
A:
Q: Consider a single base insertion mutation between the 3rd and 4th codons in a natural gene that…
A: Amino acid The building blocks of proteins. The protein is a polymer made up of chain of amino…
Q: Would a gain of function mutaion that occurs in the first exon of a gene with twelve exons more…
A: Gain-of-function type of mutation is a mutation in which the altered gene product possesses a new…
Q: Explain why it is sometimes difficult to locate genomic regions that encode a protein.
A: A gene is a DNA-based functional heredity unit that delivers instructions for the production of RNA…
Q: Upon going through the complete process of gene expression, which amino acid would be most likely to…
A:
Q: Which sequence is most likely to be found in a promoter? a) CGGTGTATATCGTAC b) GTACAGTCATCCCGT c)…
A: Promoter It is a DNA sequence that controls whether a gene is turned on or off. The promoter…
Q: Draw a typical eukaryotic gene and the pre-mRNA and mRNA derived from it. Assume that the gene…
A: The typical eukaryotic gene consists of an exon, intron, promoter sequence, a terminator sequence,…
Q: How many possible mRNAs could be derived from a gene with three exons (exon 1, exon 2, and exon 3)?…
A: Transcription is a process in which one strand of DNA known as template strand is known as converted…
Q: If a mutation were found where additional five G/C (top/bottom) base pairs were inserted immediately…
A: The mutation is a sudden and heritable change in the sequence of an organism's genome that gives…
Q: When scientists cut a eukaryotic gene from genomic DNA, they discovered that enabling the strands to…
A: Alternative splicing is a method through which a messenger RNA may control the creation of many…
Q: Human wildtype and mutant alleles are identical in sequence except for a single base-pair…
A: A mutation is any change in the DNA sequence of a cell. It may alter one or a few base pairs or…
Q: How many amino acid are in each of the two polypeptides produced? And how many nucleotides long…
A: The amino acids are produced by the DNA (deoxyribonucleic acid) through processes called…
Q: Here is the sequence of a portion of a bacterial gene. The template strand is on the bottom:…
A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…
Q: A particular transposable element generates flanking direct repeats that are 4 bp long. Give the…
A: Transposons are the DNA sequences capable of changing its position or location within the genome of…
Q: In eukaryotic cells, a poly(A) tail is normally added to pre-mRNA, but not to rRNA or tRNA. With the…
A: Mature RNA molecule results from RNA processing which involves 5' capping, splicing, and addition of…
Q: Why did geneticists believe, even before direct experimental evidence was obtained, that the genetic…
A: The amino acid sequence of proteins is determined by the sequence of nucleotides in deoxyribonucleic…
Q: A particular transposable element generates flanking direct repeats that are 4 bp long. Give the…
A: The sequence of DNA that changes position in the genome, at times reverses or creates mutations,…
Q: Geneticists have found that when they cut out a eukaryotic gene from genomic DNA that they can…
A: DNA is double-stranded, but only one strand serves as a template for transcription at any given…
Q: An ORF 1,200 bp in length can encode a protein of what size?
A: Proteins Proteins are the building block of our body they are synthesized by the process of…
Q: The mRNA sequence 5' AUG AAA CAG GGA UAA 3' encodes a particular peptide of interest to your…
A: Gene is the segment of DNA (deoxyribonucleic acid) that is responsible for heredity and inheritance…
Q: Instead, the protein produced is nonfunctional and is found to contain many fewer amino acids than…
A: Genetic code is defined as the set of nucleotides which determine the sequence of DNA of a given…
Q: Given the following MRNA sequence, what is the amino acid sequence of the polypeptide that will be…
A: The mRNA is read in the 5' to 3' direction by the transcription machinery to produce the polypeptide…
Q: Shown below is a schematic drawing of a gene, with the transcription unit divided into numbered…
A: Transcription is the process which are answerable for integrating the RNA from the DNA by the…
Q: What would be the minimum length(approximate number of bases) of an mRNAthat coded for a protein 300…
A: To determine: To determine the required minimum length of an mRNA that is coded for a protein of 300…
Q: For the following mRNA sequences, what is the amino acid sequence formed? Consult genetic code table…
A: We are provided the mRNA sequence, and we need to write the amino acid sequence formed.
Q: When a region of DNA that contains the genetic information for a protein is isolated from a…
A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…
Q: What is the complementarity rule that governs the synthesis of an RNA molecule during transcription?…
A: Complementarity is a property according to which two DNA or RNA strands bind with each other or new…
Q: The human genome contains thousands of sequences known as small open reading frames, some of which…
A: Deoxyribonucleic acid (DNA) is a genetic material and it carries genetic information from one cell…
Q: Are the 5′ untranslated regions (5′ UTR) of eukaryotic mRNAs encoded by sequences in the promoter,…
A: The 5′ UTR is located in the first exon of the gene.
Q: Given the following mRNA sequence: 5' GCCCAUGUGGCGCGAGUGAUUUAA 3' 1) Use the genetic code table…
A: Introduction The central dogma of molecular biology describes the flow of genetic information from…
Q: Draw a typical eukaryotic gene and the pre-mRNA and mRNA derived from it. Assume that the gene…
A: Eukaryotic gene is defined as the DNA regions which will act as a template for the formation of RNA…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- Could you please assist with what is not an aminoglycoside?Please help! The amino acids are leucine, serine, aspartic acid, and lysine.The following are either a term associated with protein or an example of protein, please unscramble/rearrange the letters to discover the word. iaomn sdcia eiopydpsltep gielycn ieteppd dsobn unlmbia aieknrt lcnelgoa engailt brteiu sett meyzen
- Amino acidIdentify the 20 amino acids and their corresponding three-letter and one-letter abbreviationsHow many amino acids (aa) does your protein have? 1,106 aa 551 aa 1,367aa 508aa 1,210 aa Gene Sequence (5'-to-3'): atggaccacctcggggcgtccctctggccccaggtcggctccctttgtctcctgctcgctggggccgcctgggcgcccccgcctaacctcc cggaccccaagttcgagagcaaagcggccttgctggcggcccgggggcccgaagagcttctgtgcttcaccgagcggttggaggactt ggtgtgtttctgggaggaagcggcgagcgctggggtgggcccgggcaactacagcttctcctaccagctcgaggatgagccatggaag ctgtgtcgcctgcaccaggctcccacggctcgtggtgcggtgcgcttctggtgttcgctgcctacagccgacacgtcgagcttcgtgcccct agagttgcgcgtcacagcagcctccggcgctccgcgatatcaccgtgtcatccacatcaatgaagtagtgctcctagacgcccccgtgg ggctggtggcgcggttggctgacgagagcggccacgtagtgttgcgctggctcccgccgcctgagacacccatgacgtctcacatccgc tacgaggtggacgtctcggccggcaacggcgcagggagcgtacagagggtggagatcctggagggccgcaccgagtgtgtgctgag caacctgcggggccggacgcgctacaccttcgccgtccgcgcgcgtatggctgagccgagcttcggcggcttctggagcgcctggtcg gagcctgtgtcgctgctgacgcctagcgacctggaccccctcatcctgacgctctccctcatcctcgtggtcatcctggtgctgctgaccgtg…
- C17H29COOH linolenic acid non-saponifiable ω-3 fatty acid All are correctIdentify each of the amino acid in the polypeptide and then name it using the 3-letter abbreviations.Amino Acid: Asn-Met-Ser-Ile-Phe-Arg-Cys-Tyr-Lys What is the one letter code of this amino acid and what is its classification? What is the side chain description (e.g. amide, aromatic etc.)