we done an experiment where we extracted the DNA from strawberry, grape, and peas. With the strawberries, we were able to find its DNA in the solution very easily because it was floating on the top. But for the grapes we were only able to see very small clumps which we weren't able to collect. And for the peas, we weren't able to see anything or collect any of their DNA.

we done an experiment where we extracted the DNA from strawberry, grape, and peas. With the strawberries, we were able to find its DNA in the solution very easily because it was floating on the top. But for the grapes we were only able to see very small clumps which we weren't able to collect. And for the peas, we weren't able to see anything or collect any of their DNA.

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter15: Genomes And Genomics

Section: Chapter Questions

Problem 6QP: Which of the following best describes the process of DNA sequencing? a. DNA is separated on a gel,...

See similar textbooks

Similar questions

In Figure 7-7, do you recognize any of the componentsused to make Watson and Crick’s DNA model? Wherehave you seen them before?
In figure 10.16 , how would the curve appear if the GC content of the DNA sample were increased? How would the curve appear if the AT content were increased?
Why is ligase needed to make recombinant DNA? Whatwould be the immediate consequence in the cloning process if someone forgot to add it?
If you placed one copy of your gene into a tube and ran a PCR for 3 cycles, how many copies of your gene would you have at the end?
what does it mean if our Pcr product was 6.1 nanograms per micrometers and our pcr script was 4.9 nanogramse per micrometers. we are doing a cloning experiment with Ldh dna
At the end of an experiment, you extract DNA from ten yeast colonies. You divide the DNA from each colony into two tubes, and send all twenty samples for sequencing. How many experimental replicates do you have?
In gel electrophoresis of DNA, the different bands in the final gel form because the DNA molecules ________.a. are from different organismsb. have different lengthsc. have different nucleotide compositionsd. have different genes
Which of the following best describes the process of DNA sequencing? a. DNA is separated on a gel, and the different bands are labeled with fluorescent nucleotides and scanned with a laser. b. A laser is used to fluorescently label the nucleotides present within the DNA, the DNA is run on a gel, and then the DNA is broken into fragments. c. Nucleotides are scanned with a laser and incorporated into the DNA that has been separated on a gel, and then the DNA is amplified with PCR. d. Fragments of DNA are produced in a reaction that labels them with any of four different fluorescent dyes, and the fragments then are run on a gel and scanned with a laser. e. DNA is broken down into its constituent nucleotides, and the nucleotides are then run on a gel and purified with a laser.
Before the advent of recombinant DNA technology, why was it so diffcult for geneticists to map human genes using pedigrees? How did recombinant DNA technology help move things forward?
I sequence the DNA of 3 people and see variation in my gene of interest as follows: Person 1: ATGCAACAATTTAATAAT Person 2: ATGCAACGACGACGACGACAATTTAATAAT Person 3: ATGCAACGACGACGACGACGACGACGACGACAATTTAATAAT What is the name for this kind of variation?
if You have been transported to a DNA Lab by a mad scientist. The scientist hands you a gel electrophoresis rig and he tells you to put the anode (+) and the cathode (-) on the rig correctly or... else. You have never run an electrophoresis rig in your life, nor do you know exactly what it does. However, you should be able to save your life knowing what you know about DNA. The DNA is loaded on the top of the machine and the DNA has to travel to the bottom. The machine has two metal pins, one on the bottom and one on the top. One pin can hold either an anode or a cathode, but not both. What makes sense to connect to the bottom of the anode or the cathode to get the DNA to travel in that direction? (the top will be the opposite) What is your reasoning?
An interesting trait that some bacteria exhibit is resistance to beingkilled by antibiotics. For example, certain strains of bacteria areresistant to tetracycline, whereas other strains are sensitive to tetracycline.Describe an experiment you would carry out to demonstratethat tetracycline resistance is an inherited trait encoded bythe DNA of the resistant strain.