1. What amino acids are specified by the following base triads on DNA? a. TCA b. CCt c. GGC d. GAT e. TTA 2. What amino acids are specified by each of the following codons on an mRNA molecule? a. CAU b. UCC c. AGA d. GCG e. AAA

1. What amino acids are specified by the following base triads on DNA? a. TCA b. CCt c. GGC d. GAT e. TTA 2. What amino acids are specified by each of the following codons on an mRNA molecule? a. CAU b. UCC c. AGA d. GCG e. AAA

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter15: From Dna To Protein

Section: Chapter Questions

Problem 5TYK: Which of the following statements is false? a. GTP is an energy source during various stages of...

See similar textbooks

Related questions

Q: The function of the genetic code is toa. promote transcription.b. specify the amino acids within a…

A: Genetics can be defined as the branch of biology which is concerned with the study of genes, genetic…

Q: The function of the genetic code is toa. promote transcription.b. specify the amino acids within a…

A: Genetic code is a set of rules used by living organism’s cells in the process of translation that is…

Q: If a mutation deletes the start codon in a eukrayotic gene, which of the following most accurately…

A: The start codon is a three-nucleotide long sequence in a gene that is responsible for the initiation…

Q: 5)Which type of nucleic acid would have the sequence "ACCGAUUG"? a)DNA b)mRNA c)Another type of…

A: Carbohydrates, amino acids, fats, and nucleic acids are the most important biomolecules found in…

Q: 2. The following double stranded segment of DNA is part of a protein coding gene. The segments in…

A: The genetic information of all living organisms (except some viruses) is stored in the cell in the…

Q: A portion of an mRNA attached to a ribosome reads: 5′ GACAUGAACAGC 3′ If a tRNA with a methionine…

A: In this question, we are given with a portion of mRNA which has a sequence 5' GACAUGAACAGC 3'. mRNA…

Q: transcribed RNA

A: Transcription is the process of copying a segment of DNA into RNA. Only one of the two DNA strands…

Q: 5. A DNA sequence of "ACG" will code for the amino acid - (LS1- 1) * Second mRNA base C. UUU Phe UUC…

A: Gene expression refers to the complex, highly-regulated biological process, which involves the…

Q: mutation

A: Answer: Mutations in the promoter region resulted in a change in DNA binding pattern of the AP-2…

Q: Although DNA gets all the glory, it’s actually RNA that does most of the work when cells produce…

A: In species, gene expression is a vital and essential process that helps to produce proteins by using…

Q: b) What is the MRNA sequence that would be created from the DNA template sequence above?…

A: Cell is the basic structural and functional unit of life. All the cells contains the nucleus with…

Q: The template strand of DNA is 3’AGGATGCACGTAC5’ The sequence of the mRNA that is made from this DNA…

A: The RNA sequence would be same as coding strand (except thiamine is replaced by uracil) and opposite…

Q: 1. The nontemplate strand of a segment of double- helical DNA contains the sequence:…

A: Since you have posted a question with multiple sub-parts, we will solve the first 2subparts for you.…

Q: 1. Draw a schematic of a stretch of DNA (horizontally) in the space below to represent a gene a. Put…

A: DNA deoxyribonucleic acid is a genetic material in many organisms this genetic material inherited to…

Q: 2. Given the mRNA for a protein: 5'-CCGAACGAUGGGCUAUCCCUAACCGUUU -- 3' Write the amino acid sequence…

A: The nucleotide sequence in mRNA is translated to an amino acid by rules of genetic code. A codon…

Q: When using gene therapy to treat an hereditary disease, the idea is to: A. Introduce the correct…

A: Genes are the functional segment of DNA which encode for proteins.

Q: (a.) When a mutation occurs to the given sequence of DNA, it will be; 5' CTATAAGGCGCAAATTCCTGCCAT…

A: Introduction :- Mutations are the hereditary changes that occurs in the Genetic material (DNA) of…

Q: The strand of DNA contains the sequence of bases: CGA CCG TAC. What is the sequence of the…

Q: 1. Which is the correct of mRNA strand if you have a tRNA of GCA-AUG-UCC-CGU? A.…

A: Introduction Genetic code or codon is a three letters nucleotide bases present on m RNA which code…

Q: A mutation occurs that alters the third base in an mRNA codon from a C to a G. This mutation is most…

A: Mutation is defined as the change in the DNA sequence. This can occur either during the DNA copying…

Q: o In Prokaryotes, what is the function of the 5'UTR? A. It contains the start codon It contains the…

A: The 5′ untranslated region (5′ UTR) is the region of an mRNA that is directly upstream from the…

Q: 5' Capping and 3' polyadenylation of eukaryotic mRNA : a. Destabilize MRNA b. are required for…

A: Introduction:: The correct choice is option (b).

Q: .What type of mutation is seen here? WT: 5′-AUG GCU AGA GUU GAA AAA-3′…

A: Note - Since you have asked multiple questions, we will solve the first question for you. If you…

Q: 1. Classify the type of mutation that have taken place: silent, missense and nonsense as a result of…

A: Introduction: The changes or alteration in the sequence of DNA is known as mutation.

Q: The poly A tail of an mRNA molecule was removed by a deadenylase enzyme before it is recognized by…

A: 1) Option D is correct answer for this question because It is this mRNA which decide the sequence of…

Q: n bacteria the ribosome is positioned next to the start codon by A the ribosome binding site B…

Q: 1. Given the mRNA: 5'AUGCAUGACGAUCUCGUCGCG....3' a. Use the genetic code to predict the amino acid…

A: DNA is the genetic material as it contains all the information required to make all the proteins and…

Q: 1. What is called the functional unit of a DNA molecule that may code for RNA or protein? A. arnino…

A: DNA or deoxyribonucleic acid is the molecule that is made up of polynucleotide chains coiled around…

Q: 9. A gene being expressed has the following partial DNA sequence: TACCAACCTACA. What would be the…

A: Here I will provide you mRNA sequence as well as amino acids sequences of the given DNA sequences.

Q: a. Write the sequence of the MRNA synthesized from the upper strand. b. Indicate the 5'and 3'ends of…

A: Answer : a. Sequence of mRNA synthesized from the upper stand - 5' AUGCCAUUUUGA 3' b. 5' and 3' ends…

Q: 2. If the DNA strand AAA TCG AGG CCA is transcribed to an mRNA, which 2 points shows an occurrence…

A: Note: As Per Guidelines, We Can Answer One Question At A Time. Ask Again To get rest answers.…

Q: Briefly describe the function of the following in protein synthesis: a) rRNA, b) tRNA c) mRNA

A: Ribonucleic acid (RNA) is a genetic material that is prepared from the deoxyribonucleic acid (DNA)…

Q: What does it mean when we say the genetic code is redundant? a) A single codon can specify…

A: DNA is the genetic material present in most of the living organisms. The DNA is made up of 4…

Q: 6) The diagram shows a strand of DNA matched to a strand of messenger RNA. MRNA is being made from…

A: Francis crick proposed central dogma which gives the flow of genetic information from DNA to RNA to…

Q: Which of the following statements about mRNA is correct? a. Eukaryotic mRNA is generally…

A: Introduction:- Ribonucleic acid (RNA) is a nucleic acid that has structural similarities to DNA and…

Q: Which of the following conditions will result to deactivation of a gene? a. histone methylation b.…

A: In this question we have to describe about regulation of genes . See full answer in step 2.

Q: If a mutation occurs in a coding region a. it will cause a change or changes in the normal…

A: Disclaimer: Since you have asked multiple questions, we will solve the first question for you. If…

Q: 1. Given the MRNA: 5'AUGCAUGACGAUCUCGUCGCG...3' a. Use the genetic code to predict the amino acid…

A: 1. The messenger RNA (mRNA) is produced by the process of transcription from a double-stranded DNA…

Q: b. Now do this AGAIN assuming that the DNA and RNA templates are read right to left. DNA strand DNA…

A: The mRNA is produced from the DNA template by the transcription process and then mRNA is used for…

Q: 1. The nontemplate strand of a segment of double- helical DNA contains the sequence:…

A: DNA => Transcription => mRNA => Translation => Protein. Given : Non-template strand…

Q: _______is/are removed from a new mRNA. a. Introns c. A poly-A tail b. Exons d. Amino acids

A: Nucleic acids are macromolecules. These are of two types - Deoxyribonucleic acid (DNA) and…

Q: 7. A mad scientist has all the molecules necessary for protein synthesis in a test tube. Included in…

A: The genetic material that makes up DNA is referred to as the "building block of life." Many…

Q: Which mutation changes a normal codon to another codon specifying the same amino acid a. directed b.…

A: Any change in the base pair of the sequence of base pairs that are present in the nucleic acid…

Q: 4. Which MRNA sequence complements the DNA sequence below? (LS1- 1) * A C SUP Sequence A O Sequence…

A: The DNA molecule in the cell stores the genetic information of the organism. But this information by…

Q: At the DNA level, a mutation in a protein coding region where a single base is replaced by another…

A: Mutation is the abrupt change that occurs in the sequence of DNA resulting In altered phenotype.…

Q: 6. The normal sequence a DNA and the MRNA transcribed from it are shown below. DNA-…

A: For the expression of a gene, the nucleotide sequences present in the template strand of DNA are…

Q: 1. Convert the sequence from DNA to Amino Acids. 3-TCACCACTCTGGTCTGGTCATATCTGCCTGATATGAGTACAT - 5'…

A: The translation is a process in which the synthesis of protein is done from the mRNA. The sequence…

Question

1. What amino acids are specified by the following base triads on DNA?
a. TCA
b. CCt
c. GGC
d. GAT
e. TTA

2. What amino acids are specified by each of the following codons on an mRNA
molecule?
a. CAU
b. UCC
c. AGA
d. GCG
e. AAA

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1: mRNA codons specified by DNA base triad

VIEW

Step 2: Assigning amino acid based on the genetic code

VIEW

Solution

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 3 steps with 1 images

SEE SOLUTION Check out a sample Q&A here

Similar questions

The function of the genetic code is toa. promote transcription.b. specify the amino acids within a polypeptide.c. alter the sequence of DNA.d. do none of the above.
Which two sequences shown in the diagram are NOT directly transcribed from the template strand of DNA for this mRNA? ( select all that apply) a) The exons b) 5' cap c) 3' poly-A tail d) UGA e) AUG
To facilitate movement of mRNA from the nucleus into the cytoplasm, what is added to the 3’ end of mRNA? a) Ribosomes b)Transcription factors c) A cap of modified nucleotides d) Modified tRNA molecules e) A Poly-a-tail
1. Translation a)Explain the role of ribosomes in the process of protein translation.b. Explain the role of tRNA molecules in protein translation.c. Define the following terms:1. codon 2. anticodon. Explain how a codon is used in the process of translation.
7. A segment of a DNA strand consists of ...GCTTAGACCTGA.... (a) Identify the expected nucleotide order in the complementary mRNA (b) Identify the sequence of amino acids coded for by this segment of DNA. (c) Describe the bond that forms during translation to link amino acids together. Identify the functional groups that react and the atoms involved.
Consider a template strand of DNA with the following sequence: 3 '–CAA TGT ATT TTT GCT–5 '. (a) What is the informational strand of DNA that corresponds to this template? (b) What mRNA is prepared from this template? (c) What polypeptide is prepared from the mRNA?
_______is/are removed from a new mRNA. a. Introns c. A poly-A tail b. Exons d. Amino acids
_______ are removed from new mRNAs. a. Introns c. Poly-A tails b. Exons d. Amino acids
Which of the following statements is false? a. GTP is an energy source during various stages of translation. b. In the ribosome, peptidyl transferase catalyzes peptide bondformation between amino acids. c. When the mRNA code UAA reaches the ribosome, there isno tRNA to bind to it. d. A long polypeptide is cut off the tRNA in the A site so its Metamino acid links to the amino acid in the P site. e. Forty-two amino acids of a protein are encoded by 126nucleotides of the mRNA.
During Codon recognition (a) the ribosome moves towards the 3’ end of the mRNA (b) a tautomeric shift occurs (c) a peptide bond forms (d) anticodon and codon pairing occurs (e) all of the above
What happens immediately after the initiation complex forms during translation? (a) peptide bond formation (b) the DNA associated with the promoter unwinds (c) the small and large subunits of the ribosome come together (d) primers are formed (e) phosphodiester bond formation
1). The sequence of mRNA made using the DNA double helix shown below is 2). The sequence of protein made using the mRNA is