This is homework for a practice assessment. I need some assistance with these questions, so I can use them for studying material. Thank you so much! I highly appreciate it! 6. The normal sequence a DNA and the MRNA transcribed from it are shownbelow.DNA- CCCATAATTCTGATTGTATAATGAGTCATTGAATAGTAACATDNA- GGGTATTAAGACTAACATATTACTCAGTAACTTATCATTGTAMRNA-5'-GAUUGUAUAAUGAGUCAUUGAAUAGUAACAU-3'a) Translate this MRNA, the start codon is underlined.b) Which strand of DNA is the non-coding strand?c) Label all ends of the DNA with a 5' or a 3'd) Circle the +1 on the non-template strand of DNA.e) On the DNA, draw a box around the promoter region of the gene. f) If the DNA was mutated such thatthe "A" immediately after the AUG was deleted what would be the amino acid sequence of the proteinproduced from the mutant RNA?

Answered: 6. The normal sequence a DNA and the…

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter15: From Dna To Protein

Section: Chapter Questions

Problem 5TYK: Which of the following statements is false? a. GTP is an energy source during various stages of...

See similar textbooks

Related questions

Concept explainers

Question

This is homework for a practice assessment. I need some assistance with these questions, so I can use them for studying material. Thank you so much! I highly appreciate it!

6. The normal sequence a DNA and the MRNA transcribed from it are shown
below.
DNA- CCCATAATTCTGATTGTATAATGAGTCATTGAATAGTAACAT
DNA- GGGTATTAAGACTAACATATTACTCAGTAACTTATCATTGTA
MRNA-5'-GAUUGUAUAAUGAGUCAUUGAAUAGUAACAU-3'
a) Translate this MRNA, the start codon is underlined.
b) Which strand of DNA is the non-coding strand?
c) Label all ends of the DNA with a 5' or a 3'
d) Circle the +1 on the non-template strand of DNA.
e) On the DNA, draw a box around the promoter region of the gene. f) If the DNA was mutated such that
the "A" immediately after the AUG was deleted what would be the amino acid sequence of the protein
produced from the mutant RNA?

Expert Solution

Step 1

For the expression of a gene, the nucleotide sequences present in the template strand of DNA are transcribed to form a single-strand of mRNA. These mRNA sequences are then, translated to form a long polypeptide chain of amino acids forming protein.

Trending now

This is a popular solution!

Step by step

Solved in 3 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions