What are the complementary base pairs in DNA-RNA interactions? Answer format: Base 1(one letter symbol)-Base 2 (one letter symbol, or B-B*(hypothetical N-base) In the lengthening of a polynucleotide chain, which type of nucleotide subunit (name please not the formula) would bond to its 3’ end? How many 3’,5’-phosphodiester linkages are present in a tetranucleotide segment of a nucleic acid?
Q: Consider the following image - the dotted lines represent hydrogen bonds between nitrogenous bases:…
A: There are two different type of nucleic acids and these are DNA and RNA. Four different types of…
Q: The base composition of one of the DNA chains of a DNA double helix contains 18 mol-%A, 35 mol-%T,…
A: Most organisms contain DNA or deoxyribonucleic acid as their genetic material. It is a type of…
Q: What is the "pucker" conformation of deoxyribose in the B-form structure of DNA? C2-endo…
A: Sugar puckering :- geometry of ribose sugar have 5 endocyclic TIRTIONAL ANGLES.
Q: For entertainment on a Friday night, a genetics professor proposed that his children diagram a…
A: DNA or deoxyribonucleic acid is a polymer of deoxyribonucleotides connected together via…
Q: In proteins, a peptide read from the N terminal to the C terminal. Is there a kind of direction in…
A: The DNA double helix model is generally one of the best discoveries of the 20th century. DNA is…
Q: Which of the following represents a NON-covalent bond? A) phosphodiester bond B) pairing…
A: Each hydrogen bond is much weaker than the covalent bond, they can stabilize the double helix…
Q: A circular double-stranded DNA molecule contains 4200 base pairs. In solution, the molecule is in a…
A: A higher-order DNA structure is defined by DNA supercoiling. DNA's double-helical structure involves…
Q: Which of the following statements about polynucleotide formation is correct? As a polymer, DNA is…
A: given are some statements regarding polynucleotide formation and the correct among them is given…
Q: process of going from the DNA base pairs of TAC to the amino acid methionine on a polypeptide.
A: Genes and protein synthesis Genes are the basic hereditary unit that is responsible for transferring…
Q: Match the following terms with their correct definition. The structure of double-standed DNA Hold…
A: Answer. The monomeric units of nucleic acids are called nucleotides. Nucleic acids, therefore, are…
Q: The top side of this figure offers more opportunities (for each base pair) that can lead to highly…
A: A single stranded nucleic acid is formed by joining the nucleotide units together through…
Q: What if the DNA is not a double helix, what is its implication? Explain and give example.
A: Deoxyribonucleic acid (DNA) is the genetic material present in the nucleus and cytoplasm of…
Q: f a DNA-binding protein “reads” a short stretch of DNA and detects the following “second” genetic…
A: In DNA, there are four nitrogenous bases namely, Adenine (A), Guanine (G), Thymine (T) and Cytosine…
Q: Which THREE of the following characteristics are the same in both DNA and RNA? A) deoxyribose sugar…
A: Nucleic acid are the macromolecules which are found in the cells or the viruses. It is of two types…
Q: Which of the following nucleotides found in DNA is dGTP? Note, hydrogens bound to carbon atoms are…
A: A nucleotide consists of a sugar molecule (be it RNA ribose or DNA deoxyribose) bound to a phosphate…
Q: Using the Figure below identify: What is the significance of hydrogen bonds in double helix of DN…
A: Deoxyribonucleic acid, or DNA, is a molecule that holds the information that allows an organism to…
Q: Which of the following pertains to an RNA nucleotide and not to a DNA nucleotide? Select one:…
A: DNA or deoxyribonucleic acid is the genetic material found in most organisms. Some life forms also…
Q: The compound known as nitrous acid is a reactive chemical that replaces amino groups (NH2) with keto…
A: Nitrous acid, a potent chemical mutagen, exerts its effect by the deamination of the amino groups of…
Q: If A represents 40% of the nucleotides in a particular piece of double stranded DNA, how often will…
A: As per Chargaff's rule, Amount of adenine = amount of thymine Amount of guanine = amount of cytosine
Q: A molecule has the following percentages of bases: A= 42%, C = 14%, G= 21% and T=23%. Which of the…
A: Correct option is single stranded DNA i.e. option 2 is correct .
Q: Which statement regarding polynucleotides is NOT true? Group of answer choices DNA tends to be…
A: Carbohydrates, amino acids, fats, and nucleic acids are the most important biomolecules found in…
Q: The helix of an A-DNA differs from the helix of a B-DNA in all of the following EXCEPT which phrase?…
A: DNA (deoxyribonucleic acid) is a type of nucleic acid, which acts as the genetic material. A-DNA,…
Q: These are (necessarily) present in nucleotides, but NOT in nucleosides. These are present in RNA…
A: There are many biomolecules are present in the body. Carbohydrates, lipids, protein, nucleic acid,…
Q: If a given double stranded DNA undergoes enzymatic hydrolysis targeting only the "a" side in the…
A: The hydrolysis is targetting the 3' Carbon of the sugar in the phosphodiester bond. 1st strand…
Q: Why is it unfavorable for RNA molecules to adopt a double-helix structure similar to B-DNA?
A: Introduction : Deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) are probably the most…
Q: polynucleotide strand has the bases G, T, C, and T, starting from the 5’ end. Assuming this is a DNA…
A: BASIC INFORMATION DNA It stands for deoxyribo nucleic acid. It is the genetic material of all…
Q: Which of the following feature/s characterize B-form DNA? I. Two antiparallel, polynucleoside chains…
A: The genetic material in most living organisms is present in the form of deoxyribonucleic acids…
Q: Diagram the enol form of cytosine following a tautomeric shift. Include in the diagram how this…
A: The bases of nucleotides can undergo spontaneous structural alterations known as tautomerization;…
Q: Tabulate the differences of the various DNA conformations in terms of orientation, rise per base…
A: The DNA duples model proposed by Watson and Crick was right handed spiral known as B-DNA. apart from…
Q: The two strands of a DNA double helix can be separated by heating. If you raise the temperature of a…
A: A double-stranded DNA is joined together by a bond and seems to be a twisted ladder. Which is…
Q: You are characterizing a DNA-binding protein, and have used genetic experiments to identify a domain…
A: Proteins have a secondary structure which is 3D one and the two most common of these are the alpha…
Q: Match the following terms with their correct definition. The structure of double-standed DNA Hold…
A: Monomers are the simpler units which joins to each other to make polymers. There are many polymers…
Q: Which of the following statements about polynucleotide formation is correct? As a polymer, DNA is…
A: Polynucleotides are made when a polymerase enzyme joins nucleotifes together.
Q: A duplex DNA oligonucleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG has a…
A: Melting temperature is the point at which 50% of double-helical DNA is changed into a…
Q: b. What is the difference between the 3' and the 5' ends of a nucleotide chain? C. Do the chains run…
A: The double stranded helical structure of DNA (deoxyribonucleic acid) was first demonstrated by James…
Q: Which statement about nonpolar interactions in the formation of the DNA double helix is INCORRECT?…
A: Deoxyribose Nucleic Acid (DNA) is a nucleic acid that acts as the genetic material in all organisms…
Q: What are the three possible outcomes of point mutations?
A: A mutation occurs when the sequence of DNA is altered. Mutations can occur as a result of errors in…
Q: When DNA is heated, it denatures; that is, the strands separate because hydrogen bonds are broken…
A: Introduction: DNA is the type of nucleic acid that is present in the nucleus of the cell. It is the…
Q: Which of the following correctly describes the structure of DNA? strands of phosphate-nitrogen…
A: Nucleotides are the molecules that make up DNA. Nucleotides are linked together to form two long…
Q: When comparing the structures of RNA and DNA, which of the following statements is TRUE? OA Only RNA…
A: DNA and RNA are the nucleic acid. They are polymer of nucleotide, also called as polynucleotide. A…
Q: base composition which contains 20% of the base adenine (A). (a) How many phosphor atoms are…
A: Hello. Since your question has multiple sub-parts, we will solve the first three sub-parts for you.…
Q: What does it mean for DNA to be antiparallel? -The two strands of polynucleotides are in opposite…
A: DNA is the hereditary material found in an organism.
Q: H H H.
A: The genetic material in all organisms is DNA where RNA is found in viruses as genetic material.…
Q: Which of the following is/are true about the two DNA strands that form a helix? (check all that…
A: The DNA or deoxyribonucleic acid is the genetic material in living organisms that is composed of…
Q: The two strands of a DNA double helix can be separated by heating. if you raised the temperature of…
A: In the DNA strands, between every A-T base-pairing there are two hydrogen bonds present while In…
Q: If the DNA molecule read its complementary strand as: TACGATCCGAACCAAACT, how would the m-RNA read…
A: The synthesis of m RNA and t RNA from DNA is called transcription. Thre ribosomes synthesize…
Q: Which of the following statements about polynucleotide formation is correct? As a polymer, DNA is…
A: Polynucleotides The word polynucleotides can be split into two words "poly" which means "many" and…
Q: If a 100 base-pair double-stranded DNA fragment has 40 cytosines, how many adenines does it contain?
A: The genetic information required for an organism's development and function is contained in a…
- What are the complementary base pairs in DNA-RNA interactions? Answer format: Base 1(one letter symbol)-Base 2 (one letter symbol, or B-B*(hypothetical N-base)
- In the lengthening of a polynucleotide chain, which type of
nucleotide subunit (name please not the formula) would bond to its 3’ end? - How many 3’,5’-phosphodiester linkages are present in a tetranucleotide segment of a
nucleic acid ?
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- State the properties of the WatsonCrick model of DNA in the following categories: a. number of polynucleotide chains b. polarity (running in same direction or opposite directions) c. bases on interior or exterior of molecule d. sugar/phosphate on interior or exterior of molecule e. which bases pair with which f. right- or left-handed helixThe following is diagram of a generalized tetranucleotide. Carbons exist at corners on the shapes and phosphate groups are filled circles. A. Is this a DNA or an RNA Molecule? B. Where is the 3’ end of this tetranucleotide? C. Given that the DNA strand which served as a template for the synthesis of this tetranucleotide was composed of the bases 5’-ACAG-3’, where are the expected bases?Which of the following statements is correct? A. The 3’-end of a DNA double helix implies that both strands of the DNA helix have a free 3’- hydroxyl group on that end. B. DNA can form double helix while RNA cannot form double helix. C. Both A and B. D. Neither A nor B. The role of serine at the active site of serine proteases is to act as a(n) ________ catalyst, while the histidine residue serves as a(n) ________ catalyst. A. weak; strong B. acid-base; covalent C. anionic; ionic D. covalent; acid-base E. strong; weak
- The following diagram of a generalized tetranucleotide will serve as a basis for the three questions marked “a” through “c.” (02) (a) Is this a DNA or an RNA molecule? State which _________ (b) Place an “X” (in one of the circles provided) at the 3' end of this tetranucleotide. (c) Given that the DNA strand, which served as a template for the synthesis of this tetranucleotide, was composed of the bases 5'- A C A G - 3', fill in the parentheses (in the diagram) with the expected basesIn the DNA structure, a purine molecule always binds with a pyrimidine molecule. How would you expect the structure to differ if Adenine forms base pairing with Guanine and Cytosine forms base pairing with Thymidine? Instead of A-T, G-C; can it be A-G, C-T? Justify your answer within five sentencesThe compound known as nitrous acid is a reactive chemical that replaces amino groups (−− NH2) with keto groups (== O). When nitrous acid reacts with the bases in DNA, it can change cytosine to uracil and change adenine to hypoxanthine. A DNA double helix has the following sequence: TTGGATGCTGG AACCTACGACC A. What would be the sequence of this double helix immediately after reaction with nitrous acid? Let the letter H represent hypoxanthine and U represent uracil. B. Let’s suppose this DNA was treated with nitrous acid. The nitrous acid was then removed, and the DNA was replicated for two generations. What would be the sequences of the DNA products after the DNA had replicated twice? Your answer should contain the sequences of four double helices. Note: During DNA replication, uracil hydrogen bonds with adenine, and hypoxanthine hydrogen bonds with cytosine.
- The base composition for one of the strands of a DNA double helix is 19% A, 34% C, 28% G, and 19% T. What is the percent base composition for the other strand of the DNA double helix?Draw the DNA and RNA models in Figure 1 in the space provided. Use the legend below to represent the colored plastic chips with letters. Use lines to connect the letter representations of the plastic chips according to how they are attached to each other in Figure 1. These lines represent thechemical bonds between the different nucleic acid subunits. In the case of hydrogen bonds, specify the number of bonds such that one horizontal line corresponds to one hydrogen bond. Label the 5’ and 3’ ends of your polynucleotide strands. Br brown O orange B blue P pinkW white G green Y yellow R red Structure of Genetic Material DNA RNAWhen DNA is heated, it denatures; that is, the strands separate because hydrogen bonds are broken and some base-stacking and hydrophobic interactions are disrupted. The higher the temperature, the larger the number of hydrogen bonds that are broken. After reviewing DNA base pair structure, determine which of the following molecules will denature first as the temperature is raised. Explain your reasoning. a. 5′-GCATTTCGGCGCGTTA-3′ 3′-CGTAAAGCCGCGCAAT-5′ b. 5′-ATTGCGCTTATATGCT-3′ 3′-TAACGCGAATATACGA-5′
- The double helical structure of DNA is intrinsically unstable and easily dissociates to form two separate strands. Why? How does this affect the two key biological functions of chromosomal DNA? What would happen if the DNA helices were too stable?Which of the molecules of RNA is the most likely to fold into a specific structure as a result of intramolecular (within itself) base-pairing? Explain. 5′-CCCUAAAAAAAAAAAAAAAAUUUUUUUUUUUUUUUUAGGG-3′ 5′-UGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUG-3′ 5′-AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA-3′ 5′-GGAAAAGGAGAUGGGCAAGGGGAAAAGGAGAUGGGCAAGG-3′A strand of nucleic acid is defined by its sequence of nucleotides: A, C, T, and G. How many different sequences are possible for a nucleic acid that is 200 nucleotides long? How does that number compare to the estimated number of atoms in the universe, which is approximately 1080?