5' phosphate 5' end 3' end 3' hydroxyl OH- Base pairs Sugar A: Sugar Sugar Sugar DNA Sugar Sugar Nucleotide T:A Sugar Sugar Sugar P Sugar Hydrogen bonds HO 3' hydroxyl 3' end 5' end 5' phosphate FIGURE 7.2 The Structure of DNA The two strands in the double helix are complementary. Three hydrogen bonds form between a G-C base pair and two between an A-T base pair. The strands are antiparallel; one is oriented in the 5' to 3' direction, and its complement is oriented in the 3' to 5' direction.

5' phosphate 5' end 3' end 3' hydroxyl OH- Base pairs Sugar A: Sugar Sugar Sugar DNA Sugar Sugar Nucleotide T:A Sugar Sugar Sugar P Sugar Hydrogen bonds HO 3' hydroxyl 3' end 5' end 5' phosphate FIGURE 7.2 The Structure of DNA The two strands in the double helix are complementary. Three hydrogen bonds form between a G-C base pair and two between an A-T base pair. The strands are antiparallel; one is oriented in the 5' to 3' direction, and its complement is oriented in the 3' to 5' direction.

Name: If a 100 base-pair double-stranded DNA fragment has 40 cytosines, how
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: If a 100 base-pair double-stranded DNA fragment has 40 cytosines, how many adenines does it contain? 5' phosphate5' end3' end3' hydroxylOH-BasepairsSugarA:SugarSugarSugarDNASugarSugarNucleotideT:ASugarSugarSugarPSugarHydrogenbondsHO3' hydroxyl3' end5

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter28: Dna Metabolism: Replication, Recombination, And Repair

Section: Chapter Questions

Problem 1P: Semiconservative or Conservative DNA Replication If 15N-Iabeled E. coli DNA has a density of 1.724...

See similar textbooks

Similar questions

Helicase Unwinding of the E. coli Chromosome Hexameric helicases, such as DnaB, the MCM proteins, and papilloma virus El helicase (illustrated in Figures 16.22 to 16.25), unwind DNA by passing one strand of the DNA duplex through the central pore, using a mechanism based on ATP-dependent binding interactions with the bases of that strand. The genome of E. coli K12 consists of 4,686,137 nucleotides. Assuming that DnaB functions like papilloma virus El helicase, from the information given in Chapter 16 on ATP-coupled DNA unwinding, calculate how many molecules of ATP would be needed to completely unwind the E. coli K 12 chromosome.
Semiconservative or Conservative DNA Replication If 15N-Iabeled E. coli DNA has a density of 1.724 g/mL, 14N-labeled DNA has a density of 1.710 g/mL, and E. coli cells grown for many generations on 14NH4+as a nitrogen source are transferred to media containing 15NH4+as the sole N-source, (a) What will be the density of the DNA after one generation, assuming replication is semiconservative? (b) Suppose replication took place by a conservative mechanism in which the parental strands remained together and the two progeny strands were paired. Design an experiment that could distinguish between semiconservative and conservative modes of replication.
Given the choices,a. 25b. 18c. 23d. 21how many hydrogen bonds are present in a DNA double helix fragment consisting of the following sequence in one strand: ATTGCGGTCA
Basisse triplet nommer/ Base triplet number 1 2 3 4 5 6 7 Menslike DNA-volgorde / Human DNA sequence ATG TGT CCA TTA ACG TGC ACA Name the codon that is formed from base triplet number 2 on the DNA sequence. Write down the names of the amino acids coded for by base triplets 6 and 7. Write down the full names Draw the structure of the dipeptide Thr-Cys at pH7. Clearly indicate the following: the amino terminus (N) the carboxyl terminus (C) a peptide bond an α-carbon atom If a mutation changes base triplet 1 from ATG to ATA, why will this not change the protein formed? E.The following is a sequence of base triplets in DNA F.If guanine, found in the first base…
Design a pair of primers to amplify the entire length of the following 45 base pair sequence.Make each primer 14 bases long. Write the sequences of the primers in 5' to 3' order.(Hint: It will help for you to write out BOTH strands of the DNA sequence listed below.5'-GATGCCCGTTGGATAAATTGGGCGTCTAGAATCGGTCACACTTAG-3'
pppApCpCpUpApGpApU-OH(a) Using the straight-chain sugar convention, write the structure of the DNA strand that encoded this short stretch of RNA.(b) Using the simplest convention for representing the DNA base sequence, write the structure of the nontemplate DNA strand.
DNA: 3’ TACAGTCTGTAGCGTACATTATCGTGACCGACT 5’ From the given DNA sequence above, change one base in codon 8 to show same sense mutation.Rewrite the resulting DNA sequence below and encircle the base that you changed.DNA:mRNA:polypeptide chain:b. Identify the type of base pair substitution that you applied in codon 8 Add an A before codon 3 or delete the middle base in codon 3 to show the shift of reading frame to:a. the rightDNA:mRNA:polypeptide chain:b. the leftDNA:mRNA:polypeptide chain:
The complementary strands of DNA in the double helixare held together by hydrogen bonds: G ≡ C or A = T.These bonds can be broken (denatured) in aqueous solutions by heating to yield two single strands of DNA(see Figure 1-13a). How would you expect the relativeamounts of GC versus AT base pairs in a DNA doublehelix to affect the amount of heat required to denatureit? How would you expect the length of a DNA doublehelix in base pairs to affect the amount of heat requiredto denature it?
The sequence of the complementary strand of 5' GTCTATAGAC 3' is_____________ Is there anything special about this sequence?
Which conformation of DNA – (i) totally double helix, (ii) minimally unwound or (iii) largely unwound – would have the highest relative absorbance at 260 nm. Would a molecule of DNA having a higher content of guanine and cytosine than of adenine and thymine have a higher or lower melting temperature (Tm) than one with the reverse composition?
2.1 Given the following eukaryotic DNA strand, transcribe and translate the DNA into apolypeptide using the 3’ – 5’ strand as the template. You may use drawings, diagrams,colours and annotations to describe how the DNA strand will be synthesized into afunctional protein. 5’ - TATAAAAASSMSBMDATGSBDCCMBDBAATBSMDSTGTGTCCTMSBAG – 3’ (KEY: The letters SBMD are “made up” nucleic acids that depict non-coding regions in theDNA, hypothetically S pairs with B and M pairs with D).
TRUE OR FALSE 1. Nitrogenous bases cannot undergo electrophilic aromatic substitution.2. Cytosine forms three hydrogen bonds with guanine while Adenine forms two hydrogen bonds with Thymine in themessenger RNA.3. The glycosidic bond in nucleotides is stable in dilute ammonium hydroxide solution and dilute Sodium bicarbonatesolution.4. In gel electrophoresis, a DNA is expected to migrate towards the cathode.5. Tautomerism is a phenomenon observed in both purine and pyrimidine bases.