What is the difference between transcription and translation? Transcription is the conversion from DNA to RNA; Translation is the conversion from RNA to proteins Translation happens when a transcription factor binds to the terminator region of the gene; Transcription calls ribosomes to link amino acids in a chain. There is no difference, they describe the same process Translation is the conversion from DNA to RNA; Transcription is the conversion from RNA to proteins

What is the difference between transcription and translation? Transcription is the conversion from DNA to RNA; Translation is the conversion from RNA to proteins Translation happens when a transcription factor binds to the terminator region of the gene; Transcription calls ribosomes to link amino acids in a chain. There is no difference, they describe the same process Translation is the conversion from DNA to RNA; Transcription is the conversion from RNA to proteins

Human Biology (MindTap Course List)

11th Edition

ISBN:9781305112100

Author:Cecie Starr, Beverly McMillan

Publisher:Cecie Starr, Beverly McMillan

Chapter21: Dna, Genes, And Biotechnology

Section: Chapter Questions

Problem 7SQ

See similar textbooks

Similar questions

Eukaryotic mRNA: usessnRNPs to cut out introns and seal together translatableexons. uses a spliceosome mechanism made of DNA to recognizeconsensus sequences to cut and splice. has a guanine cap on its 39 end and a poly(A) tail on its 59 end. is composed of adenine, thymine, guanine, and cytosine. codes the guanine cap and poly(A) tail from the DNAtemplate.
If the genetic code uses triplets, how many different amino acids can be coded by a repeating RNA polymer composed of UA and UC (UAUCUAUCUAUC ...)? a. one b. two c. three d. four e. five
How is translation different in prokaryotes and eukaryotes? a. In prokaryotes, because they do not have a nucleus, the translation of mRNA occurs while it is being transcribed b. In prokaryotes, pre-mRNA translation before transcription occurs within the cell c.In prokaryotes, reverse trancriptase simultaneously translates and transcribes mRNAd.In prokaryotes, functional mRNA allows for translation to be skipped, and proteins are made during transcription
What is a promoter? Group of answer choices A region on mRNA that will indicate the ending point for translation. A triplet base sequence on tRNA that is read during translation. A short sequence of a DNA upstream from a gene that determines the starting location for transcription. A triplet base sequence on mRNA that is read during translation. An enzyme that separates the two strands of DNA during transcription.
Which statement about the central dogma is FALSE? It is about the flow of genetic information. It is an outdated theory that is no longer relevant. Transcription and translation are the two steps that facilitate the flow of genetic information. The sequence of DNA specifies the sequence of mRNA, which then specifies the sequence of amino acids in the polypeptide chain.
Which one of the following features could you use to determine the length of the RNA that is produced based on the gene, before it is processed? The exon and intron sequences The promoter and enhancer sequences The start and stop codons for translation The transcription start and termination sequences
If a scientist synthesizes a DNA molecule with a nucleotide base sequence to TACGGGGGAGGGGGAGGGGGA transcription and translation what would be the amino acid sequence of the product?
Transcription and translation are separate processes in gene expression; however, they have similarties. The following terms all relate to translation. Which of these has a role that is most similar to that of the transcription start sit during transcription ? A- Start Codon B- Stop Codon C- tRNA D- Amino Acid
Which of the following happens during transcription? RNA polymerase uses DNA as a pattern to string nucleotides together to form mRNA A strand of DNA is turned into mRNA by RNA polymerase RNA polymerase makes an identical DNA copy of a certain region of the cell's original DNA All of these are steps in the process of transcription 2. Translation is the synthesis of ______ using ______ as a template. mRNA; DNA mRNA; proteins proteins; DNA proteins; mRNA 3. Steroid hormones must bind to their receptors before ______. they can enter their target cells their receptors are able to bind to DNA they can be transported in the bloodstream
in transcription, if the gene to be transcribed is 5’-ATCCGTGTAACCTT-3’, what is the sequence of the newly synthesized RNA strand? Write the sequence from 5’ to 3’. What is the sequence of the template DNA strand? Write the sequence from 5’ to 3’.
Which of the following is true about transfer RNA during translation? -Transfer RNA has anticodons that match with mRNA codons -Transfer RNA carries small ribosome subunits - Transfer RNA carries fully-functioning proteins at the end of translation -Transfer RNA carries ATP for energy during translation
Describe the process of transcription in your own words, using the following terms: activator, enhancer, promoter, DNA bending protein, RNA polymerase, transcription factors, mRNA transcript.