What is the possible consequence(s) of a Q188R mutation for the function of the protein? Keeping Galactosemia in mind for the answer.

Q: Given: Cryo-EM structure of PCoV_GX spike glycoprotein 1. What can you tell me about the identity…

A: Viruses are non-cellular particles that need a host cell to survive. Viruses are not considered…

Q: You isolate a peptide that has the sequence Met-Val-Arg-Gln-Leu-Tyr-Lys-Trp Predict whether the…

A: Amino acids are compounds containing Carbon, hydrogen, oxygen and nitrogen and serve as monomers…

Q: n as1 mutant, assign secondary structure and tell how many alpha helices and beta-pleated sheets…

A: Primary Structure: It is defined as a linear sequence of amino acids joined to each other through a…

Q: Alpha polypeptide (ADH1A). Give a detailed description of its role in the disease. Describe the…

A: Alpha polypeptide (ADH1A)- Alcohol dehydrogenase 1A is a type of enzyme which in humans it is…

Q: Pompe disease is a rare genetic condition resulting from a deficiency of the protein…

A: Pompe disease is a genetic disorder that involves the accumulation of glycogen inside the cells.…

Q: How many ATP and GTP molecules would be hydrolyzed in the synthesis of a 125 amino acid protein?…

A: ATP and GTP provide signals to drive many cellular functions.

Q: What advantages are there for synthesizing an inactive protein that must subsequently be activated…

A: When the proteins are synthesized into naive polypeptide then these are transferred to the…

Q: In TLC, why are the colors of the peaks for each amino acid are different depending on the types of…

A: TLC stands for Thin Layer Chromatography. It is a refined technique that is used for isolating or…

Q: Saccharide M, a sugar made of repeating units of maltose and cellobiose, is a component of…

A: Glycoproteins are consisted of protein and glycan moiety which is involved in several biological…

Q: 34. Which of the following proteins playsaimportant role in the geometry of sarcomere and in…

A: Titin is a filamentous protein traversing the half-sarcomere from the M-band to Z-band…

Q: Protein X can be covalently modified with many methyl groups. What two general properties would be…

A: Note: Since you have posted multiple independent questions in the same request, we will solve the…

Q: The effect of base-pair substitution mutations on protein function varies widely from no detectable…

A: It is because of the protein functionality isn't affected by the mutations occurred in the intron…

Q: What are  the differences between the MWC model and the KNF model of allosteric regulation of…

A: Several models explain the behavior of the allosteric proteins. The concerted model is proposed by…

Q: Suggest a reasonable strategy for the specific phosphorylation of the 5’ –OH group of a nucleoside.

A: Nucleosides are glycosylamines. They are basically nucleotides devoid of a phosphate group. It…

Q: 5' UGG CAA UCC UAC GAU 3' < Is it possible for a single base pair substitution to cause a truncation…

A: Yes,  it is possible for  a single base pair substitution to cause a truncation in the peptide as…

Q: What is the most consistently (i.e. found in every case) energetically unfavorable aspect of protein…

A: People have developed molecular dynamics simulations of the basic atomic forces that determine a…

Q: In the fungus Neurospora, some mutants were obtained that lacked activity for a certain enzyme. The…

A: Biomolecules are organic compounds found in living organisms. All living organism will have these…

Q: The distal Histidine (His 64) in myoglobin is subjected to three different mutations, this is one of…

A: Both hemoglobin and myoglobin are oxygen binding proteins which are found in the red blood cells…

Q: using,   3’ TGAGGCGCTAGGCCAAGCGGTAAGGATGCATGGTCGTGGTAG , What would be the resultant type of error…

A: The given sequence is 3'TGAGGCGCTAGGCCAAGCGGTAAGGATGCATGGTCGTGGTAG5' The mRNA sequence will be…

Q: Lactose exists in two Why?

A: Disaccharides are made up of two monosaccharides. Lactose is a disaccharide made up of glucose and…

Q: For genotype: repP lach lacPt lacO+ lacZt lacY Select the best description of beta-galactosidase…

A: Beta galactosidase is an enzyme which breaks the disaccharide lactose to produce galactos and…

Q: Low-resolution X-ray diffraction analysis of a protein composed of long stretches of the sequence…

A: The X-ray diffraction is one of the analytical techniques in which the X-rays are used for analysis…

Q: The SARS-CoV-2 spike protein is heavily glycosylated. What are some of the monosaccharides found in…

A: The spike (S) protein of SARS-CoV-2 mediates the virus binding to the human cells via its…

Q: This is Fos-Jun dimer (1FOS). Is the leucine zipper at the C-terminus or at the N-terminus of the…

A: Fos-jun family proteins are a class of proteins that belong to a large group of DNA binding proteins…

Q: If the molecule can inhibit toxic effects at 0.5mM against gastric carcinoma cells, does it mean…

A: IC 50 is half maximal inhibitory concentration which measures potency of substance to inhibiting…

Q: Describe how the two (or more) binding events and structural change relates to the overall function…

A: * Proteins are made by linkage of amino acids together with each protein having a characteristic and…

Q: In the serine protease triad, the proximity of an aspartate carboxylate group of histidine raises…

A: Serine protease is a class of proteolytic enzymes in which serine residue is present at the active…

Q: A random-sequence polyribonudeotide produced by polynudleotide phosphorylase, with CDP and ADP in a…

A: Amino acids are coded by a tripeptide sequence called codons. The first two positions of the codon…

Q: Assume that the translational error frequency, 8, is 1 × 10-4. (a) Calculate the probability of…

A: The translation is the process of making a polypeptide chain from mRNA. The translation is catalyzed…

Q: In pyrimidine nucleosides, the anti conformation predominates. Explain. Do the purine nucleosides…

A: Introduction and Explanation: Pyrimidines and purines are the nitrogenous bases that are present in…

Q: How Proteins in bacteria and in eukaryotes can be posttranslationallymodified ?

A: Proteins can be easily modified by doing the addition of: Methyl groups. Phosphate…

Q: A mixture of proteins having molecular weights of 50 to 200 kDa can be  fractionated linearly using…

A: 50 kDa is less elucidate..

Q: In most cases, mutations in the core of a protein that replace a smaller nonpolar side chain in the…

A: Cells have aqueous environment that is hydrophilic. So, proteins fold in a way that the hydrophilic…

Q: . Give two reasons to explain why a proline residue in the middle of an ahelix is predicted to be…

A: Proteins have different organization levels, which gives the properly folded functional form of the…

Q: and Arg29 is important in determining the structure of the protein. a) What type of amino acid is…

A: This is a question about protein fold and the importance of amino acids in folding.

Q: why this position in your protein is important and outline the effects the mutation will have on the…

A: Function of 3GRS: Glutathione acts as an important antioxidant in your body. That means it helps…

Q: Which of these mutations would you predict to be most detrimental?  Explain your answer.  (Refer to…

A:

Q: Describe the chemical difference between mannose and heptyl alpha-D-mannose. Why does FimH have a…

A: Mannose is a type of the monomer of the sugar. Mannose can be produced in the human body and it can…

Q: A mutant is found that has the following protein sequence: Met Gly Thr Leu Arg Gly. What is the…

A: Mutation is defined as the alteration in gene that result in alteration in the function of the…

Q: In studies of the amino acid sequence of wild-type and mutant forms of tryptophan synthetase in E.…

A: The nitrogenous bases that form the mRNA chain are Adenine (A), Guanine (G), Cytosine (C), and…

Q: Bradford technique makes use of the Coomassie blue dye that binds to the protein, with the complex…

A: Three different versions of the Coomassie bright blue G-250 dye are available: cationic (blue),…

Q: 1. Treating (DP) with Flouro Dinitro benzene (FDNB), followed by hydrolysis resulted in the release…

A: Biochemical methods are used for determining the order of nucleotide bases (ATP, GTP, CTP,…

Q: Which of the following changes is an example of a conservative substitution?   Question options:…

A: Substitution is a change of amino acid to a different amino acid. Mutations can result in loss of…

Q: UESTION 16 Which of the following best describes the proper sequential order of the dogma of…

A:

Q: This molecule forms a dimer via pi interactions, resulting to effective molecular stacking. If the…

A: IC50 is the half maximal inhibitory concentration of a drug that is important to know the amount of…

Q: For each of the following genotypes, explain how mutation (identified by a (-) will affect the…

A: The operon is the prokaryotic gene regulatory system that regulates the expression of polycistronic…

Mitochondrial Mutations

A mitochondrion is a cellular organelle that serves as the site for cellular respiration and energy production (ATP or Adenosine Triphosphate). It is a double-membrane-bound organelle and is only present in eukaryotic cells.