What is the resulting polypeptide: _______________________________________________________?What effect does this mutation have on the polypeptide? Make sure to compare to the original polypeptide.What effect might this have on the function of the protein? Why? n Course: 2021FA BIO 275 700 xO https://moodle.isothermal.ed xQ Lab Interactive: Mutationsb My Questions | bartlebyLab 9 DNA.doc+A Not secure | lab.concord.org/embeddable.html#interactives/sam/DNA-to-proteins/4-mutations.jsonShareAboutDNA SequenceEnter DNA sequence belowOriginal sequenceATGCCAGGCGGCGAGAGCTTGCTAATTGGCTTATAGATGACAGGCGGCGAGAGCTTGCTAATTGGCTTATAGEdited sequence(Leu(LeuGlyLeuleMetGly SerGlyThrApplyGluClick on a nucleotide to perform a mutation orEdit DNAShow DNATranscribeTranslateShow proteinContinue one stepStart/continue modelStopResetThe ConcordConsortium

Biomolecules are organic molecules present in living organisms. They include carbohydrates,…

What is the resulting polypeptide: _______________________________________________________? What effect does this mutation have on the polypeptide? Make sure to compare to the original polypeptide. What effect might this have on the function of the protein? Why?

What is the resulting polypeptide: _______________________________________________________? What effect does this mutation have on the polypeptide? Make sure to compare to the original polypeptide. What effect might this have on the function of the protein? Why?

Biology 2e

2nd Edition

ISBN:9781947172517

Author:Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:Matthew Douglas, Jung Choi, Mary Ann Clark

Chapter14: Dna Structure And Function

Section: Chapter Questions

Problem 18RQ: During proofreading, which of the following enzymes reads the DNA? primase topoisomerase DNA pol...

See similar textbooks

Related questions

Q: What type of mutation occurred to produce the abnormal sequence (nonsense or missense)? Explain your…

A: A mutation is a change in a DNA sequence.

Q: What does the chipko andolan resulted to?

A: Chipko movement is also known as Chipko Andolan. It was launched to conserve forest in India. It was…

Q: How are ribosomes affected in treacher Collins Syndrome disorder? Please write it in a…

A: Treacher Collins syndrome (TCS) is a genetic disorder which is characterized by deformities of the…

Q: The following sequence has been mutated as follows. What type of mutation is this? Original DNA: 3'…

A: Biological macromolecules are those large molecules that are necessary for the survival and growth…

Q: Answer the following questions based on the given the sequence of nucleotides in a DNA molecule…

A: Given:- The sequence of nucleotides in a DNA molecule:- 5'…

Q: What type of mutation occurred at mutation #2 and does it cause a frameshift? Sequence Original…

A: Mutation is a change in nucleotide sequence of DNA. There are various types of mutations. Point…

Q: The following are DNA fragments containing a small gene. The top strand is the coding strand.…

A: The genetic information of all living organisms (except some viruses) is stored in the cell in the…

Q: What does BCR ABL stand for?

A: B-cell receptor (BCR) serve in recognition of the antigens and are present at the surface of the B…

Q: Which isomer- (R)-arginine or (S)-arginine is D-arginine? O (R)-arginine O (S)-arginine Submit…

A: Isomers are molecules with same molecular formula and different arrangement of atoms. Enantiomers…

Q: Lay out the genetics of Nicholas’s case, including where the mutationoccurred, what exact nucleotide…

A: Nicholas was a 2 year-old boy with an extreme case of inflammatory bowel disease and susceptibility…

Q: Describe instances when a DNA mutation would not alter the function of a protein. Describe instances…

A: Genetic material is nothing but the sequence of nucleic acids which is called as DNA. It contains…

Q: Draw a hairpin structure like that shown in Figure 18.5 for the repeated sequence found in fragile-X…

A: Fragile X syndrome is a disorder that affects males more severely than females. It causes…

Q: The genetic disorder sickle-cell anemia occurs when the amino acid valine takes the place of…

A: Sickle cell anemia is a type of blood related disorder which is also known known as sickle cell…

Q: Cut the following protein with the Serine Proteolytic enzyme Trypsin. How many peptide fragments are…

A: Protein sequencing is an important aspect in the field of proteomics and molecular biology which…

Q: Please draw the structure of DNA and label the parts. Thank you very much for your help

A: Deoxyribonucleic acid (DNA): DNA is a type of molecule known as nucleic acid. It is the blueprint…

Q: What does SERMs stand for?

A: Ans: SERM: The term SERM stands for Selective estrogen receptor modulators.

Q: I want you to prepare a report of 2-3 pages summarizing the genetic disease (Kearns -sayre syndrome…

A: Kearns-Sayre condition (KSS) is a rare neuromuscular disorder with beginning generally before the…

Q: I want you to prepare a report of 2-3 pages summarizing the genetic disease (Kearns -sayre syndrome)…

A: A genetic condition is an illness caused in part or entirely by a deviation from the usual DNA…

Q: How do i find the p-value

A: In statistics, p-value is called the calculated probability. It is used when the null hypothesis of…

Q: This question refers to the mRNA sequence below: 5'-AGCUGAUGGGCUGGUGCCGAGAAAGUUAGGUAA-3' What is the…

A: During translation, the mRNA is read in triplets. The incoming tRNA reads the three bases at a time…

Q: What is the peptide bond formation? Please do not plagiarize from the internet and provide your…

A: A peptide bond is a bond formed between the α-nitrogen atom of one amino acid and the carbonyl…

Q: A portion of an unknown enzyme has the amino acid sequence serine – phenylalanine – glutamate –…

A: In Central dogma, DNA is converted into RNA through the process of transcription and RNA is…

Q: Give the amino acid sequence with some little explanation please. 5′…

A: Decoding a sequence of bases in mRNA results in the formation of either peptide, polypeptide, or…

Q: QUESTION 31 Match each of the following terms to the most appropriate description. A. the DNA…

A: CRISPR is a useful technology which can be used for editing of genes.Its a technique of finding a…

Q: What is the difference between sickle-cell amino acid sequence and normal amino acid sequence?

A: Sickel-Cell anaemia is a blood disorder in which the specifically the Red Blood Cells becomes…

Q: How do you translate this into amino acid sequence

A: The process of synthesis of protein with the help of messenger RNA is called translation. In the…

Q: What is the isoelectric point of this fragment? DHVTHLRKMG

A: Here the given peptide is: DHVTHLRKMG…

Q: I want you to prepare a report of 2-3 pages summarizing the genetic disease (Kearns -sayre syndrome…

A: Kearns-Sayre condition (KSS) is a rare neuromuscular disorder with beginning generally before the…

Q: Would love a list of different types of nucleotide repeat disorders.

A: Nucleotide is a chemical structure which constitute together to form the genetic structure that is…

Q: • Description of Phenylketonuria • Explanation of what causes Phenylketonuria • Explanation of the…

A: A) Phenylketonuria additionally called PKU, is an uncommon acquired disorder that makes an amino…

Q: In Cystic Fibrosis, what are the normal and mutated protein function

A: Cystic fibrosis is an autosomal recessive genetic disorder which affects the lungs and also the…

Q: Cut the following protein with the Serine Proteolytic enzyme Trypsin. How many peptide fragments are…

A: Proteins are unbranched polymers constructed from 20 standard α-amino acids. They have four levels…

Q: Drew the peptide sequence and write its full name Cys-Gln-Lys-His-Ala-Ser-Gln

A: All the amino acids mentioned in the question are linked Together by peptide bonds that is CONH. A…

Q: Answer the following questions. 1. List the complementary non-coding DNA sequence. This refers to…

A: The messenger RNA (mRNA) sequence is given, and we are asked to determine the complementary…

Q: Identify the type of mutation shown Original Sequence: GGC TAC ATG GAA Mutated Sequence: GGC TAA TGG…

A: A mutation occurs when the sequence of DNA changes. Mutations may occur as a result of DNA copying…

Q: How many cysteines are present in the amino acid sequence you were given? A.45 B.12 C.60 D.10…

A: Cyteines are one of the 20 amino acids which are ribosomally incorporated into proteins. This amino…

Q: hat is the delta variant

A: The Delta variant is presently the foremost distinguished strain of COVID-19, however the Lambda…

Q: 1. Partner DNA strand 2. the mRNA strand 3. The tRNA 4. the formed amino acids 5. the…

A: Given: 3’ T A C A T G C C G A A T G C C 5’ To find: 1. Partner…

Q: Why is glucose being represented as line B

A: BASIC INFORMATION TRANSPORTATION TRANSPORTATION It is a process through which one substance move…

Q: 3. Examine the following DNA sequence and determine wh type of mutation, if any, produced the…

A: A heritable genetic change in the genetic material of an organism that gives rise to alternate…

Q: What is the expansion of acronym MICA?

A: Immune system includes cells and molecules involved in protecting body against antigens.

Q: what does the Hexa protein domain depict? (in relation with tay sachs disease)

A: Beta-hexoaminidase A is an enzyme that is present in the lysozyme. It breaks down a fatty substance…

Q: What will be the amino acid sequence?

A: Each protein or peptide consists of a linear sequence of amino acids. The protein primary structure…

Q: Please help me answer the TRANSLATION AND PROTEIB SYNTHESIS 1. Beginning with DNA, describe in…

A: Protein is synthesized via translation of mRNA template by ribosomes in the cytoplasm. mRNA has…

Q: Why is a Dichotomous Key considered arbitrary

A: Introduction The word "dichotomous" refers to splitting into two parts. A dichotomous key is a tool…

Q: The following are DNA fragments containing a small gene. The top strand is the coding strand.…

A: The process by which DNA is copied to RNA is called transcription, and that by which RNA is used to…

Q: Spell out the name of the polypeptide using three letter codes for each amino acid separated with…

A: Phenyl isothiocynate is the Edman reagent. It reacts with N-terminal amino acid to give phenyl…

Q: How many base pairs are changed in the sickle cell mutation?

A: in sickle-cell anemia, the gene for beta globin is mutated. As a result the mutated protein is…

Question

What is the resulting polypeptide: _______________________________________________________?
What effect does this mutation have on the polypeptide? Make sure to compare to the original polypeptide.
What effect might this have on the function of the protein? Why?

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Similar questions

During proofreading, which of the following enzymes reads the DNA? primase topoisomerase DNA pol helicase
Below is a sequence of DNA. 5'-ttaccgataattctctctcccctcttccatgattctgattaaagaaggcgagaacgaaactatttgttaatacc-3' How many "reading frames" can be identified for this sequence? How many "open reading frames" can be identified for this sequence? What is the frame of the longest ORF?
Watch the demonstration video on nucleic acid quantification on the NanoDrop spectrophotometer: https://cutt.ly/bio150dnaquantification Note: the video is entitled RNA but the method is identical for DNA quantification. 1. At what ratio of A260/280 can we say that DNA is pure? What about RNA and protein?2. While spectrophotometric methods are effective at detecting DNA, a more sensitive but expensive technique called fluorometry is used in sensitive applications. What is the principle behind fluorometry and why is it better than spectrophotometry in detecting DNA?
The illumina method of sequencing uses a unique type of nucleotide building block. What is the specific characteristic of this type of nucleotide that is important for this method of sequencing? How is the sequence of a fragment of DNA determined using this method? (USE THIS LINK AND WRITE ANSWERS IN YOUR LANGUAGE PLEASE DON'T COPY SAME AS GIVEN IN SITE https://www.mybiosource.com/learn/testing-procedures/dna-sequencing/
Answers must be precise and concise. You can use other sources of information related to the topic. QUESTION: How will knowledge of recombinant DNA technology be useful to resolve the current challenges and issues we are facing today? Cite an example.
The following are DNA fragments containing a small gene. The top strand is the coding strand. Transcribe all groups and translate. FIND THE POSSIBLE MUTATIONS Group D 5’-GGCAATGGGTTTGTGCAATTCTAACAGTTTTTAATTC-3’ 3’-CCGTTACCCAAACACGTTAAGATTGTCAAAAATTAAG-5’ Group E 5’-GGCAATGGGTTTTGCAATTCTAAAAGTTTTTAATTC-3’ 3’-CCGTTACCCAAAACGTTAAGATTTTCAAAAATTAAG
Choose the correct gel electrophoretic pattern that would be seen in dideoxy sequence analysis of the DNADNA molecule shown below. pGGCGACCGATTAGTCCCATCGATGGG−OH
The following are DNA fragments containing a small gene. The top strand is the coding strand. Transcribe all groups and translate. FIND THE POSSIBLE MUTATIONS Group B - MUTATION 5’-GGCAATGGGTTTGTGAAATTCTAAAAGTTTTTAATTC-3’ 3’-CCGTTACCCAAACACTTTAAGATTTTCAAAAATTAAG-5’ Group C- 5’-GGCAATGGGTTTGTGCAATTCTAAGAGTTTTTAATTC-3’ 3’-CCGTTACCCAAACACGTTAAGATTCTCAAAAATTAAG-5’
How we prepared the sample of DNA and what kinds of tracking dye we add to sample in SDS-PAGE ? Please mention the source of the information. write the resources, any single resource
Please help me answer this reviewer. Determine what the statement is describing. Fill in the blanks with the correct/best answer. 1. A fermentation method used by several industries like the pharmaceuticals, food, textile etc., to produce metabolites of microorganisms using solid support in place of the liquid medium. answer: 2: Whole fish whose DNA has been purposefully altered by directly integrating (or deleting) one or several genes to introduce or modify a targeted character. answer: 3. The process of transferring genetic materials into a living cell using glass micropipettes or metal microinjection needles. answer: 4. Preservation of components of biological diversity outside their natural habitats. Thank you very much for your help
LO 64- Explain how Next gen sequencing is applied in different technologies In which of the following scenario would it be best to use Next-gen sequencing? (select all that apply) a-To separate fragments of DNA based on their size- b-To insert a mutation at random in a gene c-To idently a novel pathogen d-To determine the nucleotide sequence of a microbe e- To insert methyl groups to cytosines in a DNA sequence asap please
Can you explain thie each of the statement given i dont really understand the dna recombinant is used as a molecular cloning and application for recombinant dna