What protein is the target for most or all O the RNA-dependent RNA polymerase O the ORF 8 protein Othe spike protein myosin heavy chain

Q: The 5'-Cap on viral mRNA plays a critical role in: Maturation and stability of the MRNA…

A: The first co-transcriptional modification of mRNA is the addition of a 5' (guanine-N7 methyl) cap.

Q: ins that mady De (A) constitutive proteins B B isoforms C spliceosomes

A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids…

Q: An intein gets spliced out of a RNA O MRNA O DNA protein

A: Deoxyribonucleic acid(Double-stranded) is the main genetic material in higher organisms. It is…

Q: ge Ho onis pa re "hanging down

A: The transcription factor of the RNA polymerase two has the following functions: TFIID:…

Q: Ih ribosome complex has a catalytic activity to form peptide be Select one: O a. a specific protein…

A: Ribosomes - Ribosomes are Ribonucleoprotein particles that contains ribosomal RNA and r- proteins.…

Q: My PDB code: 3GRS residue point: 66 (LYS) mutation: VAL

A: 3GRD.PDB is the crystallographic structure of GLUTATHIONE REDUCTASE solved at1.54 ANGSTROMS…

Q: The protein Ras O is required for both growth and differentiation of many cells O has one…

A: Ras genes belong to the category called protooncogenes and they regulate various important life…

Q: O It protects mRNA from enzymes that might break it down O The tail consists of a string of As…

A: The addition of poly A tail to a mature  mRNA is a post transcriptional modification that occurs in…

Q: ws the standard (coding strand) DNA amino acids involved in protein synthesi plate strand is shown…

A: DNA replication is a process in which DNA itself form DNA . It is two stranded , ladder like and…

Q: TFID controls translation O replication transcription O protein activity

A: as per the guidlines we are supposed to answer only first question, please repost the other question…

Q: Why is the Ras small GTPase so dangerous when it is no longer able to hydrolyze GTP to GDP? O A CTD…

A: RAS protein  RAS proteins are small group of GTPase which main function is to transmit signals…

Q: Select one or more: O a. by the interaction of Rho and Rho binding sites in RNA. O b. by the…

A: Transcription is the process of making mRNA from DNA.it is always in the 5' to 3' direction.

Q: Match the terms with the type of transposon B. IS A. retrotranspson abundant in humans A L1 8 DNA…

A: A DNA (deoxyribonucleic acid)  that is capable of transposition, such segments are mostly found in…

Q: Which of the following is true at the time introns are spliced our nRNA? O Only the 3' end of MRNA…

A: Introns are defined as noncoding sections of an RNA transcript, or it can be the DNA encoding it.…

Q: A mutant that has coated vesicles form that fail to undergo scission - separation - from their…

A: Clathrin-mediated endocytosis is the transport of cargo molecules from the cell membrane to the…

Q: I. The retinoic acid receptor (RAR) is a transcription factor that is similar to steroid hormone…

A: The retinoic acid receptor is a kind of receptor which can act as transcription receptor. There are…

Q: egions сар, S protein_mut, 3'-UTR, poly (A) tail etc) and why are they included in the MRNA?…

A: mRNA : It is a single stranded molecule of RNA which corresponds to the genetic sequence of a gene…

Q: Riboswitches are a type of RNA in bacteria that can start or stop a step in gene expression.…

A: Regulatory genes are those genes which are meant for controlling the function of the structural…

Q: TRNA has peptidal transferase activity. 1 point True False Genetic information stored in mRNA 1…

A: Q. tRNA has peptidal transferase activity. True False   Q.Genetic information stored in mRNA is…

Q: Translation of the mRNA occurs in the GC rough ER smooth ER cytoplasm nucleus

A: The translation is the process of synthesizing a protein from the information contained in a…

Q: If you wanted to study a newly discovered ion channel from a bacterium in isolation from other…

A: Approaches have made their way into the field of C. elegans, a model organism that has been used for…

Q: s the standard mino acids involved in protein synthesi late strand is shown below GCCCG-3' uence of…

A:

Q: FR-facing side of a tiunsnembrane Protein ends vP Gth cor N teimiinal depend on Pootein 8. A…

A: In the peptide molecule, the amino acid residue on one end has an amine group on the alpha carbon…

Q: Messenger RNA transfers the from the cell nucleus to the cell cytoplasm. O the code related to a…

A: RNA is type of nucleic acid which is comprised of single-stranded polynucleotide chain and…

Q: The glycolytic enzyme pyruvațe kinase is activated by dephosphorylation and inactivated by…

A: Pyruvate kinase It is an important enzyme of glycolysis that aids in the conversion of…

Q: A mutation occurs in the of a gene, but the disease is caused by transiatioH Ul a OA.MRNA.…

A: Mutations are the spontaneous changes which results due to the impact of various chemicals, UV rays…

Q: Predict the sequence of amino acids coded by the mRNA sequence 5’ GGA–GGC–ACA–UGG–GAA 3’

A: The single strand of the RNA molecule, which consists of a gene sequence and carries the message…

Q: Which of these is unique to how the MRNA is structured compared to pre-MRNA O MRNA combines with…

A: Note: As Per Bartleby Guidelines For Further Answers Please Repost The Question. Introduction: mRNA…

Q: Protein undergoes modifications in ER before reaching their final destination. True O False pH of…

A: Proteins are synthesized by ribosomes which translate mRNa  in polypeptide chains . These proteins…

Q: In the case of the insulin receptor (IR), the RNA-binding protein RBP described in lecture in muscle…

A: RNA binding proteins bids to mRNA based on structure or sequence and form ribonucleoprotein…

Q: RNA interference refers to the phenomenon in which the presence of a leads to the silencing of a…

A: RNA is the nucleic acids similar to the DNA and contains uracil instead of the thymine. It plays…

Q: Strong stop DNA forms during the first step of: RNA transcription O Reverse transcription O RNA…

A: Introduction: Reverse transcription is the process of synthesis of DNA from RNA using the enzyme…

Q: In Tetrahymena, the removal of the single intron in the rRNA precursor does not involve a protein. O…

A: Central dogma includes three steps of transfer of genetic information which are replication,…

Q: In Figure 6-19,a. what do the square/triangular pegs and holesrepresent?b. is the suppressor…

A: Mutation is a permanent change in the genetic material (the genome) of a cell of a live creature or…

Q: Select the incorrect statement: OA Transcription produces an MRNA of a gene that leaves the nucleus.…

A: a. We know that genes or DNA are kept in the nucleus. Ribosomes are present outside the nucleus,…

Q: Small nuclear RNAS (SNRNAS) regulate O gene transcription O MRNA transport into the cytoplasm O MRNA…

A: Answer) Small nuclear RNAs (snRNAs) regulate the splicing of mRNA precursors. Small nuclear RNAs…

Q: GGGAGTGTATACGGGATGAAGGCGATT MRNA What’s the Protein And what’s the phenotype

A: The sequence of mRNA is CCCUCACAUAUGCCCUACUUCCGCUAA. CCC- PROLINE UCA - SERINE CAU - HISTIDINE AUG-…

Q: BONUS: Within a cell, positive sense single stranded RNA acts as O FRNA O SİRNA tRNA O MRNA

A: Introduction: Positive-strand RNA viruses or +ssRNA viruses are a group of viruses that are related…

Q: 3. snRNA is produced in transcription. 4. Initiator tRNA enter ribosome with the help of EF-Tu. 5.…

A: Transcription is the process of synthesis of RNA. The process of transcription requires RNA…

Q: The 5'-Cap on viral mRNA plays a critical role in: Maturation and stability of the MRNA…

A: The 5' cap is done during the maturation of the mrna for translation. This process is called…

Q: GAC TATGCGGGA GGT GAAGCC ATGA would happen If fourrt A in the given sbrand mutated to t 2 And in…

A: Mutations are changes in the DNA sequence that occurs as a result of errors in the DNA copying…

Q: Bully whippets are homozygous for a deletion of two base pairs in the myostatin gene. This deletion…

A: Deletion is defined as the removal of bases from the nucleotide sequence of a gene.

Q: "In this mutation, the AGC is transcribed into UAG." O missense mutation nonsense mutation O silent…

A: The replacement of a single base pair leads to the appearance of a codon i.e. stop codon, which is…

Q: A function of transfer RNA (ERNA) is to: O copy DNA and carry the information to the ribosome stay…

A: A transfer RNA is an adaptor molecule composed of RNA, typically 76 to 90 nucleotides in length,…

Q: A synthetic RNA molecule with the sequence GCGCGCGCGCGCGCGCGCGCGCGCGCGCGC is mixed into the cell…

A: Synthesis of proteins from information on mRNA template on the ribosomal set up is termed as…

Q: DNA sequence that stimulates transcription are referred to as O activator O silencer O enhancer O…

A: Transcription is the preliminary degree in gene expression, whilst facts from a gene is used to…

Q: A single mutation in one of the transcription factors inProblem 33 results in a drastic reduction in…

A: Introduction A mutation occurs when the sequence of DNA changes. Mutations can occur as a result of…

Q: diagram shown represents the coding strand of the myosin gene. in myosin lead to muscie delects…

A: The correct answer is Option E - LANE 5 Explanation The regulatory region of a gene is a sequence of…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.