ins that mady De (A) constitutive proteins B B isoforms C spliceosomes
Q: What is meant by resistant? Give the mechanism by which organisms develop resistance.
A: Antibiotics can be classified based on the mechanism of action. These functions include the antimicr...
Q: Ribonuclease A cannot catalyze the hydrolysis of DNA. which of the following statements explains it...
A: Deoxyribonucleic acid (DNA) is a polymer made up of two polynucleotide chains that coil around each ...
Q: Explain the importance of knowing the conformation/structure of proteins.
A: Proteins are biomolecules composed of amino acids. The amino acids are joined together through pepti...
Q: Give the name of the enzyme in this reaction along with detailed
A: Coenzyme A is a coenzyme which plays important role in the synthesis and oxidation of fatty acids, a...
Q: (Part A) Coenzyme-dependent enzymes can catalyze the general transformations shown below. What would...
A: The process of translation takes place in the cytoplasm which converts mRNA to protein/en...
Q: SDS-PAGE reagents that play a role in denaturing the protein sample include (Select all that applies...
A: Proteins are present in their globular structure till they don't get denatured by something extraord...
Q: For beta-oxidation of an 18:1 oleate mono-unsaturated fatty acid: - How many Acetyl CoA produced? - ...
A: Fatty acids are molecules with hydrocarbon chain and carboxylic acid group. In the absence of glucos...
Q: What name is given to the predominant secondary structure found in wool protein?
A: Because estimating tertiary structure only based on amino acid sequence may not be sufficient, secon...
Q: 5' 3' For numbers 6 to 10, refer to the image above and answer the questions. 6. Which among the two...
A: Hi! Thanks for your question. As you have posted multiple questions and have not mentioned which one...
Q: Assessing the efficacy of glucosamine and chondroitin sulfate for arthritis pain Treatment with...
A: Many patients with arthritis, particularly osteoarthritis, utilise vitamins in their diet to relieve...
Q: correct or incorrect. CORRECT INCORRECT Proteins in a primary structure consist of a simple polypept...
A: The base level of the protein hierarchy is the primary structure, which is the specific linear seque...
Q: Bradford technique
A: The Bradford assay is based on the use of the dye Coomassie Brilliant Blue G-250, sometimes known as...
Q: Design a strategy to make a subtracted-complete cDNA library from liver cells. Use a flowchart metho...
A: cDNA is also known as complementary or copy-DNA and is synthesized using mRNA as template and enzyme...
Q: GIVEN: Centrifuge A: rotor radius - 5 cm; max. speed - 4,000 xg Centrifuge B: rotor radius -7 cm; ma...
A: Centrifugation is a process that uses centrifugal force to separate mixtures. A centrifuge is a devi...
Q: Explain the role of CDK inhibitors. If cyclin-CDK complexes are necessary to allow regulated progres...
A: Cyclin-structured kinases (CDKs) were considered promising drug targets for some years, however, max...
Q: Some of the following four amino acids : alanine, arginine, histidine, aspartic acid would provide a...
A: Introduction: Acid-base catalysis is a mechanism in which the transfer of a proton from an acid decr...
Q: Which of the following is NOT a unit of concentration? All of these options are units of conce...
A: The specific activity is the activity of the enzyme present per milligram of the total enzyme.
Q: 7. Which of the following statement is true? A. oxidative rancidity is observed more frequently in a...
A: Introduction: Rancidity is the development of unpleasant smells in fats and oils that is often acc...
Q: ion. What cause mentioned changes? For the
A: Amino acids are building blocks of proteins which can be divided into two group based on its catabol...
Q: You'lre hungoy, body Cmuttiple g the following e optim posei ble) which Occur in Our toonelete (A) À...
A: Hungryness is a feeling that stimulates food intake. There are number of pathways that stimulate goo...
Q: Draw two diagrams, one showing what enzymes and products are produced when GLN is high and one when ...
A: Gln in question stand for Glutamine. Glutamine is an amino-acid exist in L-form like other amino aci...
Q: *Which of the following statements about allosteric enzymes is NOT true? Question 10 options: - They...
A: Ezymes are boost up chemical reaction in body.allosteirc enzyme are type of Ezymes.Allosteric enzyme...
Q: Which of the following statements are FALSE? Multiple answers:Multiple answers are accepted for th...
A: Which of the following statements are FALSE? Multiple answers:Multiple answers are accept...
Q: 1. Which of the following molecule can act as molecular chaperons for assisting the folding of prote...
A: A broad set of unrelated protein families whose function is to stabilise unfolded proteins, unfold t...
Q: 1. Draw NEW amino acids; name them and characterize them, following the rules and properties of the ...
A: Amino acids contain amino group and carboxyl group along with R side chain. The R side chain defines...
Q: *Which of the following statements about allosteric enzymes is NOT true? Question 10 options: - They...
A: Allosteric enzymes are the Enzymes that possess allosteric sites at which inhibitor or activator bin...
Q: What are the types of genes and their functions ?
A: Introduction: Gene is a basic unit of hereditary information and it determines the inherited charact...
Q: Chapter 15 Reading Question 5
A: The acylation of the three hydroxy groups of glycerol with palmitoleic acid produces 1,2,3-tripalmit...
Q: Which of the following condition is NOT associated with riboflavin deficiency? * (Please choose one ...
A: Riboflavin is a water soluble vitamin. It is also called as B2 vitamin. Foods like pork, eggs, chees...
Q: Name the following nucleotide: HN P-0-P-0-CH2 OH
A: Nucleic acids are macromolecules. These are of two types - Deoxyribonucleic acid (DNA) and Ribonucle...
Q: The cell concept CANNOT apply to ____
A: Cell theory (a unifying principle of biology) was formulated by Schleiden and Schwann. Cell theory s...
Q: The lock-and-key theory described the action of ______. Select one: a. enzymes as locks that fit oth...
A: Lock-and-key theory describes the formation of an enzyme substrate complex. The complementarity betw...
Q: Is Sodium Phosphate A Competitive Or Noncompetitive Inhibitor Of Alkaline Phosphatase?
A: Enzyme is a biocatalyst. It speeds up biochemical reactions. It is mostly protein based though some ...
Q: Below are the structures of three phosphate-containing molecules. Which one has the lowest Phosphory...
A: Phosphate group is containing one phosphate group atom attached to four oxygen molecule.Various mole...
Q: 1) Based on the composition of fatty acids present in each TAG , predict which TAG (X, Y or Z)has th...
A: Note : Hi ! Thank you for the question. We are authorized to answer three subparts at a time. Since ...
Q: Which of the following statements concerning structural characteristics of bile acids is CORRECT? * ...
A: Bile acids are a collection of acidic steroid molecular entities with unusual physical, chemical, an...
Q: Which of the following statements is NOT TRUE about tyrosine? O It is an essential amino acid. O It ...
A: OPTION A: Tyrosine is a non-essential amino acid as the body makes it from phenylalanine. OPTION C:...
Q: Large proteins travel/migrate fast
A: SDS is an essential component in protein gel electrophoresis, generally known as SDS-PAGE (short for...
Q: What assay could be used to test the function of a protein in the glycoside hydrolase family?
A: Glycoside hydrolases are enzymes that catalyze the hydrolysis of the glycosidic linkage of glycoside...
Q: Why does it make sense that under conditions of low ATP levels in the cell the pyruvate carboxylase ...
A: Glucose is degraded to pyruvate through the process of glycolysis that occurs in the cytoplasm. Pyru...
Q: (a) Propose a biosynthetic pathway to the secondary metabolite, B. OH O HO Metabolite B
A: The given metabolite structure is derivative of Salicylaldehyde and synthesized by plant as secondar...
Q: What is the biological importance of carbon, nitrogrn and phosphorus?
A: Biomolecules are organic substances, which are majorly composed of carbon. Nitrogen and phosphorous ...
Q: estion properly and accordingl
A: The saponification value of oil is measured by the number of milligrams of potassium hydroxide (KOH)...
Q: I. True or Flase a. An inhibitor may compete with the substrate for binding to the active site of ...
A: Enzymes are proteins which act as biocatalysts. Enzymes increase the rate of biochemical reactions a...
Q: Ethidium Bromide is a chemical reagent that has been used to detect the presence of nucleic acids. I...
A: Nucleic acids are of two types : DNA and RNA. DNA refers to Deoxyribonucleic acid. It is genetic mat...
Q: histidine has three pka values: pka=1.7 pk2=6.0, pka 9.1 a- for each pka, find the equilibrium cons...
A: Consider the acid dissociation reaction at equilibrium; HA⇌H+ + A- here 'HA' is the acid 'H...
Q: unfold the protein
A: here they are talking about protein unfolding. The tension applied by the cantilever during protein ...
Q: We have described an ATP synthase complex with an Fo complex of 9 c-subunits. Consider if the F0 com...
A: In order to solve this problem, first we need to identify the reaction catalyzed by the enzyme β-hyd...
Q: Classify each protein as fibrous or globular. A. albumin B. myosin C. fibroin
A: Globular proteins are characterized by having globin like fold. Globin heme bonding protein with rou...
Step by step
Solved in 2 steps
- GTTTTCACTGGCGAGCGTCATCTTCCTACT 8. What is the function (e.g. transcriptional regulation, transmembrane signaling, kinase, protease, etc.) of the protein(s) encoded by the gene.Many ribosomes may associate with a single mRNA to form multiple copies of a polypeptide simultaneously. Such strings of ribosomes are termed as?Which statements decribe the function of the protein encoded by this gene CAGATTGTGAAGAGGTCTCTTGA? A. Break point cluster region protein that may function as a GTPase B. A coagulation factor C. An enzyme involved in the breakdown of glycosaminoglycans (GAGs) D. Transcription factor involved in the DNA damage response E. A component of hemoglobin F. A tyrosine kinase G. Serine/threonine kinase involved in the DNA damage response H. A tumor suppressor involved in WNT signalling I. A DNA repair enzyme involved in nucleotide excision repair
- in the endoplasmic reticulum and Golgi-complex, the determination of proper folding depends on what type of post- translational modifications? help me to understand what the answer is as i am doing correction so i can get points back.N-linked glycoproteins are glycosylated co-translationally at which consensussequence? A) Asn-X-Ser B) Met -Gly -X-Asn -X-Ser C) no specific sequence D) Ser- Asn -Thr E) Cys- X-Asthe difference in primary structure between related tropomyosin informs arises from a) alternative splicing b) C-to-U editing c) farnesylation d) H3K4 methylation e) targetting to secretory vesicles
- The genetic code was deciphered by experiments in which synthetic polyribonucleotides of known repeating sequences were used as mRNAs to direct protein synthesis in cell - free extracts . What type or types of polypeptides would you expect to be synthesized if poly (AAG) n (A) AAGAAGAAG ) used as the template for in vitro peptide synthesis ?Exploring the nuanced landscape of protein dynamics, could you elaborate on noteworthy post-translational modifications (PTMs)? I'm interested in understanding specific examples of PTMs and gaining insights into their functional mechanisms. This inquiry delves into the intricate aspects of protein modulation within a biological context."Splicing machinery must recognize three portions of the precursor RNA molecule: the 5’ splice site, the 3’ splice site, and the exon junction complex (EJC). True or false
- 46. The SH2 protein domain has 2 binding sites: one for ________ and one for _________. A. Phosphotyrosine; {a}- methyltyrosine B. C- Terminus; N-terminus C. Phosphotyrosine; flanking amino acids D. Alpha Helices; Beta-Pleated SheetsTranscription & Translation A. Describe mRNA splicing. B.How do mRNA and rRNA interact? C.How do mRNA and tRNA interact?One single polypeptide chain (120 amino acid residues) is produced for protein A in prokaryotic cell. N-terminal amino acid is alanine in the chain of this protein. How many moles of ATP and GTP will be in use for this polypeptide chain synthesis? What post-translational modifications may be for this protein?