GAC TATGCGGGA GGT GAAGCC ATGA would happen If fourrt A in the given sbrand mutated to t 2 And in case 06 MRNA what Iwas what Would be The sequna 2
Q: ture MRNA. What are these modifications and what are their significance? Use = following terms to…
A: When introns are eliminated and the mRNA is regarded suitable for translation, eukaryotic pre-mRNA…
Q: it mRNA will be formed from the template strand of DNA? AUGGUGCA at amino acids will this mRNA code…
A: The process by which DNA template synthesizes messenger RNA is called transcription. The other…
Q: If the DNA gene reads AAT GGT CCA CCG CTG, what will the MRNA read? O A. TTA CCA GGT GGC GAC O B.…
A: DNA is a macromolecule and is composed of nucleotides having sugar , phosphate and nitrogenous bases…
Q: ........ cen not be true about in ditu hybridization. Use to reveal where gene expressed at mrna…
A: In-situ hybridization spots specific nucleic acid sequences within intact chromosomes, eukaryotic…
Q: The second MRNA molecute is the acias they code Ior. same as the original mRNA except it has an…
A: Mutation It is defined as the alteration in the sequence of DNA due to the exposure to some mutagens…
Q: GS 42 CI G4 AUG AUG CUC CUC ACG GAC Uuc UAC CGG R (the strand Y CUC GAG AAG The circled structure…
A: The process shown in the image is Translation where with the help of ribosome and tRNA from the mRNA…
Q: intron-Seauence of nueleotides klith in the gene but are r emeved fürm the Ŝeaçuente a final MKNA…
A: Ribonucleic acid (RNA) modifications refers to alteration in the chemical composition of ribonucleic…
Q: Coding DNA 5’- GTG ACT CGT TGT GCC ATT GCA GCT AAA CAC TTC GAG CCC TGT- 3’ mRNA 5’- GUG ACU CGU UGU…
A: A genetic code translates the genetic information encoded within the deoxyribonucleic acid (DNA) or…
Q: 1. Write the complementary coding strand sequence 5' GGG ATG TCA CAC ATA TTT 2. Write the mRNA…
A: The coding strand of DNA is the one that contains the instructions for the gene in concern. The…
Q: +1 1 4 6. 7 8 9. Transcriptional stop sequence +1 ТАTA box ATG ТАА AUG UAA Here is a diagram of a…
A: A base pair is two nucleotides that together constitute DNA ladder." A DNA nucleotide is composed of…
Q: ble opposite shows the standard (coding strand) DNA codes for the 20 amino acids involved in protein…
A: Introduction :- Gene expression is the process of formation of response or functional part through a…
Q: Which of the following is true at the time introns are spliced our nRNA? O Only the 3' end of MRNA…
A: Introns are defined as noncoding sections of an RNA transcript, or it can be the DNA encoding it.…
Q: Exonucleases can digest the poly A tail of eukaryotic mRNAs in the 3' to 5' direction which thereby…
A: Transcription is a process through which the template strand of DNA gets transcribed into mRNA. In…
Q: egions сар, S protein_mut, 3'-UTR, poly (A) tail etc) and why are they included in the MRNA?…
A: mRNA : It is a single stranded molecule of RNA which corresponds to the genetic sequence of a gene…
Q: Following is an mRNA sequence reported in data base. 5’ ACC AGA ATG ACC ATG GCA 3 This is an mRNA…
A: mRNA stands for messenger RNA and it corresponds to the genetic sequence of a gene which is read by…
Q: I’m supposed to translate tRNA into amino acids for each codon of the previous question and state…
A: Hi. After accepting the question, I see that you have incorrectly solved 2b and 2c. I am giving you…
Q: The method of Northern blotting is used to determine the amountand size of a particular RNA…
A: A gene is a stretch of nucleotides present on a chromosome. It is the region that encodes the…
Q: The epigenome for a particular gene determines whether it will
A: When certain chemical compounds or proteins are attached externally to the genome or the DNA, such…
Q: The 3' end of eukaryotic pre-MRNAS are changed by: O phosphorylation of the MRNA molecule. copying…
A: Need to find what changes the 3' end of eukaryotic pre mRNA.
Q: A mutation occurs in the of a gene, but the disease is caused by transiatioH Ul a OA.MRNA.…
A: Mutations are the spontaneous changes which results due to the impact of various chemicals, UV rays…
Q: Prokaryotic Eukaryotic FRNA MRNA TRNA hnRNA snRNA FRNA get of zibiotic ugs pped to pid Terioration…
A: Introduction :- RNA is a polymeric molecule . Role of RNA in different cellular processes ==…
Q: ure 1 is a bacterial gene (1-180). The first base to be transcribed is the base located at sition…
A: Transcription is a process in which RNA is formed with the help of template strand of DNA. It…
Q: You saw this figure many times during the WC1 group work. To get from the biomacromolecule(s)…
A: Biomacromolecules are the complex polymers of different monomer units (simple). In a human body,…
Q: DNA AGAGTTCTGCCCTGTCGATTT mRNA mino Acid Sequence Which kind of protein molecule did this gene make?
A: The order of amino acids from the amino-terminal to the carboxyl-terminal of a protein is generally…
Q: 7. A promoter is an example of a(n) O regulatory sequence. O chromatin sequence. O transposable…
A: A promoter is a DNA sequence that defines where transcription of a gene by RNA polymerase begins.…
Q: Transposable elements cause mutations when insertedwithin a gene. These elements disrupt the…
A: Transposable elements (TEs) are deoxyribonucleic acid (DNA) sequences that move from one location to…
Q: RNaseP O processes the 5' end of tRNAS contains an RNA component O both a and b O none of the above
A: A ribonuclease is an enzyme that cleaves ribonucleic acid (RNA). RNA is a single stranded structure…
Q: You have just gotten back the results from an RNA-seq analysis of mRNAs from liver. You had…
A: RNA-Seq which is expanded as RNA sequencing is described as a sequencing technique that makes use of…
Q: In test tube 1 (no puromycin) you get a polypeptide that is 90 amino acids long. At least how many…
A: The translation is the process of the formation of polypeptide chains of amino acids that lead to…
Q: 5’ AGGATCAACACCTGTACATGG 3’ 3’ TCCTAGTTGTGGACATGTACC 5’ Label the sense and antisense strands…
A: DNA is ladder like , helical structure which have ability to form its own copies via DNA replication…
Q: The amino acid sequence of part of a protein has beendetermined:N . . . Gly Ala Pro Arg Lys . . . CA…
A: Genetic codes are used to translate the information encoded within the genetic material. A codon is…
Q: . While perusing the E. coli K12 genome sequence,you come across a gene with no known function.…
A: Genome is defined as an organism’s complete set of DNA with all of its genes present. This will…
Q: 18. In order to m protein. You crea guide RNA comp sequence Gene that the CRISPR Gene Yis neces: a.…
A: CRISPR/ cas 9 Clustered regularly interspaced short palindromic repeats is a gene editing system…
Q: GGGAGTGTATACGGGATGAAGGCGATT MRNA What’s the Protein And what’s the phenotype
A: The sequence of mRNA is CCCUCACAUAUGCCCUACUUCCGCUAA. CCC- PROLINE UCA - SERINE CAU - HISTIDINE AUG-…
Q: Another thalassemic patient had a mutation leading to the production of an mRNA for the β chain of…
A: Thalassemias are hereditary blood diseases in which hemoglobin synthesis is reduced. Thalassemias…
Q: Eukaryotic RNA polymerases can be distinguished by their sensitivities to ( ). 50 Each bacterial…
A: Eukaryotes have mainly three types of RNA polymerases that transcribes different types of RNA. RNA…
Q: c) A gene in a bacteria has the following DNA sequences (the promoter sequence is positioned to the…
A: Introduction :- In moelcular biology , the expression of gene is the most important event , that…
Q: A mature transcr Select one: a. 5' UTR b.introns С. ехons O d. Poly A ta e. guanine f.3' UTR
A: The 5′ untranslated region is the region of an mRNA that is directly upstream from the initiation…
Q: = exons = introns Transcription termination site (also poly A site) Promoter Start of transcription…
A: Transcription is the process which consists of several steps of DNA-based gene expression. Here a…
Q: Jesse is a cat from an old cartoon. The show was only produced in black and white, and Jesse now…
A: Given, ACC GCG GTT TAC TTT GCC CGA ATT GAT GA
Q: A short RNA molecule was isolated that demonstrated a hyperchromic shift indicating secondary…
A: Answer- The DNA is converted by the transcription into mRNA. This process happens in the nucleus of…
Q: Scientists have exploited the siRNA pathway toperform a technique called RNA interference—ameans to…
A: Ribonucleic acid interference is the technique that can potentially inhibit the function of a…
Q: The following diagram depicts the elements at the: Ac TTC g99 Eca cgcc tataan ATT BRE TATA box Inr…
A: The core promoters are contiguous DNA sequences sufficient to initiate the accurate initiation of…
Q: Original DNA ЗТАС ACC TTG GCG ACG ACT'S sequence: MRNA transcript: amino acids: Is the "original DNA…
A: DNA ( Deoxyribonucleic acid ) is two stranded , ladder like helical structure that act as genetic…
Q: How would the artificial mRNA5′. . . GUGUGUGU . . . 3′be read according to each of the following…
A: In molecular biology, a reading frame refers to a method of separating the nucleotides sequence…
Q: GAC UAU GCG GGA GGO AAG CA UGA iwhat is The auino a cid that would Lesult from this m RNA SeepuenU?
A: Adenine in RNA binds with uracil (Thymine is replaced by uracil in RNA) and guanine with cytosine.…
Q: What is the tRNA triplets codon that would fit the mRNA- 5' AUG AUC UAU GGG CCA AUU GCA UGA 3'
A: The three triplets which are complementary to the mRNA sequence forms the anticodon in transfer RNA.…
Q: sequences oT two con the following bacterlal promoter. The startpoint of transcription is shown in…
A: Transcription is the act of copying and interpreting information from a DNA strand into a new…
Trending now
This is a popular solution!
Step by step
Solved in 3 steps
- If the sequence of the coding strand in a transcription unit is writtenas follows:5' -ATGCATGCATGCATGCATGCATGCATGC-3'Write down the sequence of mRNAHow is it possible that a given mRNA in a cell is found throughoutthe cytoplasm but the protein that it encodes is only found in afew specific regions?PLEASE MAKE THE DR BRUJIN GRAPH From these k-mers construct a de Bruijn graph and determine the sequence of the contig. AGCG ATCT ATGA ATGG ATTC CCCT CCTG CTCT CTGA CTGC CTTT GAAG GATT GCGT GCTC GTTC TATG TCAT TCTA TCTT TGAA TGAT TGGA TGTT TTCA TTCC TTTC
- From TAC CTA CTC TAG TTA ACC ACA GTT GCC ATC. Translate the mRNA sequence.Assuming that each nucleotide is 0.34 nm long in mRNA, howmany triplet codes can simultaneously occupy space in a ribosomethat is 20 nm in diameter?Given this DNA strand: 3’ TACAGTCTGTAGCGTACATTATCGTGACCGACT 5’ Identify the following: mRNA: polypeptide chain:
- CTA GCC CTC CGT TAC TAG TTA CCT ACT TAT TCA ATT TTG TAA ACG CTC ATC CGA ACC CGC TTT TAA TTG CCC ACT TAG TCG ATT ACC CGT TTA TGT TAA TTA CCT ATC 2. Figure out the tRNA triplet (codons) that would fit the mRNA triplets. (letter by letter): (2) (a) Using the codon table, show the consequences of adenine base addition to thebeginning of the following coding sequence on the subsequent translation. CGA-UCG-GAA-CCA-CGU-GAU-AAG-CAU asapPredict the sequence of amino acid coded by the mrna sequence 5’ GGA-GGC-ACA-UGG- GAA 3’