Q: What amino acid is coded for by the mRNA codon 5'-GAG-3'
A: In this question, we have to describe GAG triplet codon code for which amino acid.
Q: TRACE THE CODE| Order of bases in MRNA (codon) AUC Order of bases in ERNA (anticodon) Order of bases…
A: Complete this table of codes.
Q: The DNA sequence contains the complete sequence for a small gene. What amino acid sequence does this…
A: DNA sequence of genes code for the sequence of amino acids in proteins. There are two strands in…
Q: 70. Which of the following codes for the stop codon in mRNA? A.UUC B.UGA C.AUG D.AAA
A: Answer B) UGA
Q: Which of the following mutations would be more detrimental to an organism? 1) a mutation that…
A: Mutations are the alterations in the DNA that can happen either due to internal factors like…
Q: The following diagram illustrates a step in the process of translation. Identify the following…
A: The translation is a process through which a polypeptide chain is synthesized based on the sequence…
Q: Which enzyme links amino acids to the 3’ OH group of an RNA? (a) ribozyme (b) peptidyl…
A: The translation is a process of converting mRNA molecules to amino acids which take place in the…
Q: Which codon codes for the C-terminal residue in the polypeptide structure shown below? H3N 'N' NH3 H
A: GENETIC CODE is the relation between the base sequence of a gene and the amino acid sequence of the…
Q: Which of the following anticodons can recognize BOTH codons for Aspartate (Asp)? Question 36…
A: The deoxyribonucleic acid (DNA) is the double-stranded molecule that is the genetic material in most…
Q: Suppose you discover a new bacterial species, which utilize codons consisting of two nucleotides…
A: Generally, we know codons are the three-nucleotide sets, which are essential to be transcribed into…
Q: If the codon in the mRNA is 5' AUG', then the anticodon of the initiator tRNA is 5' CAT3' O 3' UAC5'…
A: CODON- It is a unit of three nucleotides that forms a genetic code in a DNA/RNA.
Q: o In Prokaryotes, what is the function of the 5'UTR? A. It contains the start codon It contains the…
A: The 5′ untranslated region (5′ UTR) is the region of an mRNA that is directly upstream from the…
Q: What is the correct tRNA anti-codon sequence for the AUG mRNA sequences? a. UGA b. UAC c. CAU d.…
A: Transfer RNA (tRNA) is a small RNA molecule that plays a key role in protein synthesis.
Q: What is the anti-codon in tRNA that corresponds to the codon pGpCpA in MRNA? А. рТрGpC В. рСpGpT С.…
A: During replication and transcription a nucleic acid was copied from another nucleic acid. Hence this…
Q: An mRNA has the following sequence: 5' ACCAUGUACUGUCCUGCUGUUUGA 3'. Beginning from the start codon,…
A: In Amazon instant there are four type of nucleotide bases i.e adenine, guanine, cytosine and uracil.…
Q: An RNA sequence includes 15 bases. How many amino acids does this sequence encode? 3 0 5 O 15 O 45
A: RNA is a molecule that consists of a single strand of nucleotides. It is a product of transcription…
Q: What is added to the 5' end of eukaryotic mRNAs? a methyl-guanosine CAP a poly-A tail a Kozak'…
A: At first, the terminal phosphate of the three 5′ phosphates connected to the furthest limit of the…
Q: Which of the following MRNA sequences codes for the polypeptide sequence tyrosine-leucine-alanine?…
A: The mRNA is a single-stranded molecule of RNA that corresponds to the genetic sequence of a gene.…
Q: An mRNA has the following base sequence:5′–CAGGCGGCGAUGGACAAUAAAGCGGGCCUGUAAGC–3′Identify the start…
A: Hereditary qualities are a piece of science stressed over the examination of qualities, hereditary…
Q: An MRNA has the codon 5' GUA 3'. What tRNA anticodon will bind to it ? A) 5' CTA 31 B) 5' ATC 3' C)…
A: DNA replication is the process of formation of identical copies of DNA. It occurs in the nucleus of…
Q: Given the codon UCA in the first exon of a gene, which change is most likely to result in a nonsense…
A: A nonsense mutation is one in which change in nucleotide will result in a stop codon. This will…
Q: The coding strand of DNA in a segment of a gene is as follows: ATG GGC CTT AGC. This strand carries…
A: The DNA (deoxyribonucleic acid) duplex consists of a non-template and a template strand. The…
Q: Which amino acid is carried by the tRNA with the anticodon 5'-UCA-3'? None-this is a stop codon. OI.…
A: The process of translation helps in formation of long chains of amino acids ie, polynucleotides. We…
Q: Which of the following is located at the C-terminus of a newly synthesized eukaryotic proteins?…
A: Initiation of translation occurs when the small ribosomal subunit binds with initiation factors and…
Q: Which of the following mutations would cause translation to end? O Mutation 1 O Mutation 2 Mutation…
A: Translation is the process where protein gets form. Here the start codon is AUG and the estoppel…
Q: The anticodon loop of one of the t RNA Gly molecules from Escherichia coli is as follows: C--G G--C…
A: tRNA is a specialised RNA molecule that transports the amino acids during translation. A tRNA is…
Q: Which structure is responsible for translating MRNA? O a. RNA Polymerase II O b. RNA polymerase I O…
A: Introduction Messenger ribonucleic acid (mRNA) is a single-stranded RNA molecule that corresponds to…
Q: A single base substitution mutation is likely to have a less harmful effect when the base change…
A: Point mutations are the mutation which cause change in nucleotide base at specific position . It can…
Q: In one (1) sentence point out a key functional similarity and difference in each of the pair of…
A: Amino acids are the building blocks of proteins that are classified as acidic, basic, and Amino…
Q: How many unique MRNA codons can be constructed from the four different RNA nucleotides? A. 4 В. 8 С.…
A: mRNA codon:- An mRNA codon is a 3 base pair long part of the mRNA that codes for a specific amino…
Q: The tollowing mRNA transcript would result in which polypeptide sequence? 5'-ACU UUC ACU AUG UUU UUA…
A: Protein consists of amino acids linked by amide bonds or peptide bonds.
Q: transcribe the following DNA strand into mRNA and translate that strand into a polypeptide chain,…
A: Alleles are considered as the variant of the gene. DNA is composed of different nucleotides that…
Q: In which of the following does nitrogenous base pairing (base complementarity via hydrogen bonds)…
A: Nitrogenous base pairing can include DNA-DNA, DNA-RNA, RNA-RNA pairing. Both DNA and RNA are made up…
Q: In bacterial mRNA, the initiating AUG codon is preceded several nucleotides away by a purine-rich…
A: Translation is the process by which a polypeptide is formed using an mRNA as its template.…
Q: How many ATP are required to synthesize a polypeptide of 98 residues in translation? А. О В. 97 С.…
A: Polypeptide is made up of different amino acids and these amino acids are joined together through…
Q: Which three codons would code for a different amino acid sequence from that coded for by the mRNA…
A: Given: mRNA base sequence: AGU-UCA-CCA Have to determine which three codons will code for a…
Q: What will be the sequence of the single-stranded RNA transcribed from the following segment of…
A: Answer: TRANSCRIPTION : It is the process in central dogma in which single stranded RNA is formed…
Q: Which of the following observations indicates that a genetic code is non-or A base insertion…
A: The genetic code is a set of rules that living cells use to convert information found in genetic…
Q: Codon to be read in the mRNA is 5' GAA 3', what is the amino acid? a. E b. K c.F d.L
A: Dear student answer of your question is given below: Given codon in the mRNA is 5' GAA 3' , It…
Q: . ) In one (1) sentence point out a key structural similarity and difference in each of the…
A: Biomolecules are abundant biological molecules present in the body like carbohydrates, proteins,…
Q: A series of tRNAs have the following anticodons. give all possible codons with which each tRNA can…
A: Anticodon relatable term with another term which is codon. A codon is a three-nucleotide stretch of…
Q: What amino acid sequence will be generated, based on the following MRNA codon sequence? 5' AUG- UCU-…
A: The genetic code is the precise sequence of DNA nucleotides interpreted as three-letter words or…
Q: In a ribosome, a maximum of TRNA molecules can be bound to the MRNA at any one time. O1 3 64
A: During translation, tRNA molecules first bind to the amino acids that correspond to their binding…
Q: Which statement about transfer RNA (TRNA) is NOT correct? Select one: O It folds up into the shape…
A: Transcription in the process which is responsible for synthesis of RNA from the template strand of…
Q: If you have 30 MRNA bases, how many amino acids would that code for? O 10 3 1
A: A triplet codon is where each codon consists of three, nonoverlapping, nucleotides. The code is…
Q: Here is an mRNA sequence (written 5' → 3') A G G G A G G U A A C A G 14 15 16 17 18 19 20 21 24 27…
A: The translation initiation codon is the 5'-AUG-3'. From this codon the first amino acid is…
Q: If MRNA has the bases UAU, what is the matching tRNA? O UAU O ATA O TUT O AUA
A: DNA(deoxyribonucleic acid) is the genetic material in all organisms except few viruses. The genetic…
Q: The number of amino acids produced by translating the mRNA (3'AUGCUUAGUCGCGUA5') is : a. 4 b. 5…
A: The three letter codes for amino acids are the universally accepted amino acid codes that are…
Q: The role of transfer RNA (tRNA) is to match a codon (3 bases) in mRNA sequence to: A. An amino…
A: The process of protein synthesis is also known as translation. It is possible with the help of…
Q: The following diagram illustrates a step in the process of translation. Identify the following…
A: The diagram illustrates the process of elongation of polypeptide chain by adding amino acids one by…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- From this overall anticodon sequence in tRNA, 3'-CAUCGGAAUAGAUCGCUAGUGGCAGGCAUAAUGAUCACCGGUCUGAGAAAAGUGGUACAUAUCAAC-5' What is the amino acid sequence that will be coded for using THREE-letter amino acid code starting from N-terminus to C-terminus.With in vitro translation of an RNA into a polypep-tide chain, the translation can begin anywhere along the RNA molecule. A synthetic RNA mole-cule has the sequence 5'-CGCUUACCACAUGUCGCGAAC-3'. How many reading frames are possible if this molecule is translated in vitro? How many reading frames are possible if this molecule is translated in vivo, in which translation starts with the codon AUG?How many different aminoacyl-tRNA synthetases are there in a cell? 64 20 61 45 30
- From this overall anticodon sequence in tRNA, 3'-CAUCGGAAUAGAUCGCUAGUGGCAGGCAUAAUGAUCACCGGUCUGAGAAAAGUGGUACAUAUCAAC-5' What is the amino acid sequence that will be coded for using ONE-letter amino acid code starting from N-terminus to C-terminus and using THREE-letter amino acid code starting from N-terminus to C-terminusAn RNA polymer is made by using the enzyme polynucleotide phosphorylase with equal quantities of CTP and GTP. When this RNA is used in an in vitro translation system, all of the following amino acids could be incorporated into a newly made polypeptide, except: glycine (Gly) histidine (His) proline (pro) alanine (Ala) arginine (Arg)There are four codons that encode threonine. Consider the leader sequence in Figure 31.22A. What codons are used and with what frequency?
- Three E. coli tRNA molecules with the anticodon sequences CGG, OGG , and UGG are charged with the same amino acid. What is the amino acid ?37Transposons in eukaryotes are mechanistically different from bacterial transposons. Yesorno 38The tRNA has a ( ) secondary structure. 39A single ( ) can be processed to produce two molecules or more different mRNAs.Suppose RNA is synthesized in vitro using the polynucleotide phosphorylase enzyme with a 3:1 ratio of C and G nucleotides (3C:1G ratio). If you were to use the resulting RNA to synthesize protein in an in vitro translation system, what percentage of the total amino acids in the protein would be made up of proline (Pro)? 56.25% 6.25% 42.19% 18.75% 0%
- The genetic code was solved partly by the use of in vitro systems to translate synthetic RNAs into peptides. In these systems, ribosomes, amino acids, and buffers that support translation are added and there is no control of where translation begins. AAA = Lys; AUA = Ile; AAU = Asn; UAA = stop. What peptides would NOT be produced in an in vitro system if the following oligonucleotide were added: AAAAAAAAAUAAAAAAAA Select one: a) Lys-Lys-Lys-Lys-Lys-Lys-Lys-Lys b) Lys-Lys-Ile-Lys-Lys c) Lys-Lys-Asn-Lys-LysA mutation called base substitution mutation had been altered the sequence in a. eliminated the synthesis of all the polypeptide except one. The altered sequence is 5’ – AUGCAUACCUAUGUGACCCUUGGA – 3’. Use the genetic code table and determine why.Using the following list of codons describe, using diagrams etc., how information stored in the DNA is translated into a peptide. Be sure to discuss all steps. In other words, use a diagram and give me sequences, transcription and translation steps. Show the sequences of the sense and the other DNA strand, the mRNA and the tRNA’s. UUU -phenylalanine UCU -serine AUG –initiation/methionine CUU -leucine ACU -threonine GUU -valine UAA -Termination