I need help please The inflammation response is trigger by cytokinesand histamine release by macrophages and mastcells respectively. What type of chemical signalmechanism is this an example of?paracrineendocrine (hormone)O neurotransmitter Which cells are part of the INNATE immuneresponse?Select all that apply.O B cellsO Cytotoxic T cellsO Dendritic cellsO Helper T cellsO MacrophageNatural Killer Cell

Immunity is the ability of an organism to resist infections and diseases. The immune system is…

Answered: Which cells are part of the INNATE…

Which cells are part of the INNATE immune response? Select all that apply. B cells Cytotoxic T cells Dendritic cells O Helper T cells Macrophage O Natural Killer Cell

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter17: Genes And The Immune System

Section: Chapter Questions

Problem 4QP

See similar textbooks

Related questions

Q: Results of Inoculated Media A B C D E F G H I J K Based on the results of the media shown above,…

A: Pseudocysts are abnormal fluid-filled sacs that can form in various parts of the body, including…

Q: 1-Pedigrees exhibiting consanguinity, show increased presence of _________ traits? a-Dominant…

A: Consanguinity refers to the mating or breeding of closely related individuals such as cousins or…

Q: A Search (Me UAC mRNA GGG AUGCCCACG Which letter indicates a codon? 1 UAG S G O POD 5:32 PM 4/7/2029

A: Translation in molecular biology and genetics is the procedure that allow ribosomes in the cytoplasm…

Q: The alveoli and blood capillaries make up the gas exchange surface of the lungs, and as the arrows…

A: Gas exchange is the process by which oxygen and carbon dioxide are transferred between the…

Q: Which process is illustrated in the diagram? Pre-mRNA Exon 1 Lariat Exon 1 BEIN Intron Step 1 Step 2…

A: mRNA splicing is a process by which a newly made precursor messenger (m) RNA transcript is…

Q: Give an example of 1 antibiotic that targets each of the following in a bacterial cell (1 antibiotic…

A: Antibiotics are a class of drugs used to treat bacterial infections by either killing the bacteria…

Q: Select an IPCC scenario using the drop-down menu under the power plant labeled Anthropogenic Carbon…

A: The phenomenon of global warming is fraught with hazards owing to the escalating temperatures it…

Q: The diagram shows the components that comprise the Gastrointestinal System. label components A-J.…

A: The gastrointestinal (GI) system, also known as the digestive system, is a complex network of organs…

Q: What was wrong with this child when he was transferred to the university hospital? Based upon your…

A: Bacterial infections are caused by harmful bacteria that invade and multiply in the body, leading to…

Q: Normally, a tRNA with the anticodon 3'-UUA-5' would be connected to which amino acid? Asn Oleu Asp…

A: T-RNA resembles a clover leaf or an inverted L in form. It contains complimentary nucleotides to…

Q: Catalase is an enzyme responsible to toxify; H₂O2 toxify; H₂O detoxify; H₂O2 detoxify; H₂O from…

A: Enzymes are biocatalyst that perform specific biochemical reaction inside of the living organisms.…

Q: Although numerous treatments are available for advanced hormone receptor- positive (HR+) and human…

A: Cancer is a group of diseases characterized by uncontrolled growth and spread of abnormal cells.…

Q: Record the results you obtained for the following tests and organisms: INDOLE PRODUCTION ORGANISM…

A: The nitrogen reduction test is a biochemical test that is used to determine whether an organism has…

Q: Question: Some states are setting up archives of DNA profiles for all convicted criminals. Should…

A: A investigative method used to identify people based on their DNA is called DNA profiling, also…

Q: are hallmarks of cystic fibrosis. Chronic bacterial infections of the intestine Buildup of mucus…

A: Cystic fibrosis (CF) is a genetic disorder that affects various organs in the body primarily the…

Q: Griffith's Experiments using Streptococcus pneumonia rough and smooth strains concluded which of the…

A: Streptococcus pneumoniae also known as pneumococcus, is a Gram-positive spherical-shaped bacterium…

Q: The following four mutations have been discovered in a gene that has more than 60 exons and encodes…

A: The DNA sequence varies from organism to organism. The order of the base pairs may sometimes shift.…

Q: Explain how to maintain the health of the vertebral column (vertebrae) describing at least three…

A: The vertebral column also referred to as the spine or spinal column, is a flexible structure made up…

Q: B 444b 44444 Rh on #4 - Suzie A Rh 6. What is Trevor's blood type genotype? B- 7. What blood types…

A: The ABO blood group is based on the presence of specific antigen on the RBC. During blood donation,…

Q: Explain how a nervous impulse is transmitted along the axon of a nerve cell, including the…

A: An impulse refers to the electrical signal or action potential that travels along the axon of a…

Q: In a male insulin-like factor 3 'knock out' mouse, predict the phenotype: Select an answer and…

A: Male insulin-like factor 3 (INSL3) is a hormone produced by the Leydig cells of the testes in male…

Q: AUGCCGCAAUCUGUUCACGCACUCAUGUG TII CAC & CACICATETE Direction of synthesis- BTTT ATGCCGCA сш TTT…

A: The term "mRNA" is defined as a single-stranded molecule that carries genetic code from DNA used to…

Q: In the figure below, mitosis is represented by which number? Also which number represents DNA…

A: Cell division is the process by which a single parent cell divides into two or more daughter cells.…

Q: Bacteriophage A 200 μl of bacteriophage A was added to 800 μl of E. coli broth culture. The mixed…

A: The stepwise dilution of a solution to reduce its concentration is called serial dilution. In…

Q: Where are microtubules and microfilaments most abundant within a non-dividing interphase cell?

A: The cytoskeleton is an extensive structure that provides shape, strength, and motility to a cell.…

Q: The most commonly found phenotype in the natural population of a species is called the?

A: Phenotype refers to the physical and observable characteristics of an organism that are determined…

Q: Explain the results for each organism. *Nitrate Reduction E. Coli (+) P. aeruginosa (-)

A: Nitrate reduction is a common laboratory test used to determine the ability of microorganisms to…

Q: THE MOLECULAR GENETICS OF CYSTIC FIBROSIS The following is the base sequence of DNA that codes for…

A: According to our guideline we can answer only first 3 subparts of a question. So, upload rest of the…

Q: Draw a whitefish blastula cell in interphase (400x)?

A: Given below is the blastula cell of whitefish. The cell cycle of this organism is in the interphase…

Q: D. Е. F. 1. А. B. с. Under each sequence of bases, write the sequence of bases complementary to each…

A: A complementary sequence in the context of DNA refers to the sequence of nucleotide bases that can…

Q: Answer by listing only the name of the disease. Some questions will require the name of the…

A: A bacterial infection is an illness caused by the growth and spread of harmful bacteria within the…

Q: Which statement about transposons is INCORRECT? a.A transposon is a small fragment of DNA that…

A: Genes make proteins, which are important for our body to work properly. That's why it's really…

Q: What is the disulfide? Can you explain to me, please? Also, can you give me an example of the…

A: Disulfide is an compound that is made up of two atoms of sulphur in its empirical formula. Its…

Q: Australopithecus had the following characteristics of more advanced bipedalism a. a…

A: Australopithecus is an extinct genus of hominins that lived in Africa between 4.2 million and 1.4…

Q: Explain the concept of excess energy in photosynthesis and describe how high light and/or low…

A: Photosynthesis is a process by which green plants, algae, and some bacteria convert light energy…

Q: Q3.24. Nutrient retention is an important concept that is often used to help understand and mitigate…

A: Biological systems require the proper sum of supplements to remain healthy, work well, and be…

Q: In the electron transport chain, which has the higher redox potential, Cyt a3 or Cyt c1?

A: The electron transport chain (ETC) is a series of redox reactions that occur in the inner…

Q: which of the following statements about algal bloom and eutrophication is true? 1. Eutrophication…

A: Algal bloom occurs in stagnant water in which the growth and division of algae is increased that is…

Q: Describe the processing of Pre-mRNA

A: Pre-mRNA or precursor mRNA is the initial transcript produced during transcription of a gene in…

Q: The exact start site for protein synthesis on the mRNA is AUG and base pairs with a tRNA carrying…

A: A codon is a sequence of three nucleotides (adenine, cytosine, guanine, or uracil) in DNA or RNA…

Q: Answer by listing only the name of the disease. 1.A 21 year old woman presents with a swollen…

A: A 21-year-old woman has a big eye puff. It was caused by Chlamydia trachomatis, a germ that makes a…

Q: 4.- Please explain, the how does the dark-field microscope function?

A: Since you have asked multiple questions, we will answer the first one. Please submit another…

Q: A 6 year old child comes in with crusted pustules localized around her mouth. When the doctor finds…

A: Microbes are microscopic organisms that cannot be seen as such through naked eyes but need…

Q: ARTICULATIONS IN THE HUMAN BODY

A: Joint (or articulation)- the junction between two or more bones.With the exception of the hyoid…

Q: Select the alternatives that indicate an advantage of GMOs. A. GMOs can have improved nutritional…

A: Plants or animals that have had specific genes modified in their genetic makeup are known as…

Q: How can nurses assist in managing chronic diseases?

A: It is a disease that is persistent and long-lasting. The term 'chronic' is usually used when the…

Q: ch organism) *Reaction of Nitrogen Metabolism Indole Production E. Aerogenes (-) E. Coli (+) P.…

A: The indole test is a biochemical test used to determine the ability of microorganisms to produce…

Q: Explain the concept of Photostasis and give an example of an abiotic factor causing an energetic…

A: We must define the term "Photostasis" and provide an illustration of an abiotic agent that results…

Q: Explain how polyploidy in plants can generate new plant species. Be sure to provide molecular…

A: Polyploidy refers to organisms that have more than two sets of chromosomes in their cells. While…

Q: Draw a whitefish blastula cell in metaphase (400x)?

A: Cell division is the process by which a single parent cell divides into two or more daughter cells.…

Concept explainers

Immunology

Immunology is the division of science involved with the immune reactions occurring in living organisms. The organisms are accustomed to evolving internal defense mechanisms to evade the invasion of microbial pathogens. Diverse cells are connected with stimulating the immune responses, which produce inhospitable conditions to the microbes prompting their lysis and thus inhibits the multiplication of the pathogens. The immune system can distinguish the pathogens through the aid of cellular intercommunication and launch responses to destroy them.

Question

I need help please

The inflammation response is trigger by cytokines
and histamine release by macrophages and mast
cells respectively. What type of chemical signal
mechanism is this an example of?
paracrine
endocrine (hormone)
O neurotransmitter

Which cells are part of the INNATE immune
response?
Select all that apply.
O B cells
O Cytotoxic T cells
O Dendritic cells
O Helper T cells
O Macrophage
Natural Killer Cell

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1: Immunity

Step 2: Question 1

Step 3: Question 2

Solution

Step by step

Solved in 4 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Which innate immune system component uses MHC class I molecules directly in its defense Strategy? a. macrophages b. neutrophils c. NK cells d. interferon
Match the immune cell with its main function. ___dendritic cell a. professional phagocyte ___B cell b. antigen-presenter ___helper T cell c. activates other lymphocytes ___NK cell d. makes antibodies ___macrophage e. kills ailing body cells that lack MHC markers
Match the immunity concept with the best description. ___anaphylactic shock a. recognizes antigen ___immune memory b. inadequate immune response ___autoimmunity c general defense mechanism ___inflammation d. immune response against ones own body ___immune deficiency e. secondary response ___antigen receptor f. acute allergic reaction ___antigen processing g. presenting antigen together with MHC markers
The humoral immune response depends on which cells? a. TC cells b. B cells c. B and TH cells d. TC and TH cells
Match the immunity concept with the best description. _____ anaphylactic shock a. recognizes antigen _____ immune memory b. insufficient immune response _____ immune deficiency c. general defense mechanism _____ autoimmunity d. immune response against ones own body _____ antigen receptor e. secondary response _____ inflammation f. acute allergic reaction
Figure 42.11 Which of the following statements about T cells is false? Helper T cells release cytokines while cytotoxic T cells kill the infected cell. Helper T cells are CD4+, while cytotoxic T cells are CD8+. MHC II is a receptor found on most body cells, while MHC I is a receptor found on immune cells only. The T cell receptor is found on both CD4+ and CD8+ T cells.
Innate immune responses include all but (a) inflammation (b) antigen-antibody complexes (c) binding of PAMPs with pattern recognition receptors (d) complement (e) phagocytosis
The ability to develop a secondary immune response is based on ______. a. memory cells b. circulating antibodies c. plasma cells d. effector cytotoxic T cells e. mast cells
The Adaptive Immune Response Is a Specific Defense Against Infection Name the class of molecules that includes antibodies, and name the five groups that make up this class.
The Adaptive Immune Response Is a Specific Defense Against Infection Identify the components of cellular immunity, and define their roles in the immune response.
Match the immunity concepts: __________ inflammation __________ antibody secretion __________ phagocyte __________ immunological memory __________ vaccination __________ allergy a. neutrophil b. plasma cell c. nonspecific response d. purposely causing memory cell production e. basis of secondary immune response f. nonprotective immune response
Researchers have been trying to develop a way to get the immune system to accept foreign tissue as self. Can you think of some clinical applications for such a development?